MEGAResFrom MEG, the Microbial Ecology Group

TET45

The tet45 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>CARD|phgb|GU584222|0-747|ARO:3003196|tet45|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET45
AGAAAATAGGGGTAAAGCATTTGGTATTATTGGGTCCATTGTAACTATGGGAGAAGGTGTCGGACCATCTGTTGGTGGAG
TGATTGCCGAATATGCCCATTGGTCTTATATACTGCTTTTGCCTGTTGTAACGATTATCACTGTTCCATTCCTTGCAAAA
TTATTGAAACAGGAAGAGGTAATAAAAGGATCTTTTGATACTAAAGGAATAATATTTATGTCCGTAGGCATTGTATTTTT
TATAATGTTTACGACATGTTATAGAGTTTCCTTTCTAGTCGTTAGCATAATATGTTTCTTAATATTTGTTAAGAATATTA
GGAAAGTGTCTAATCCTTTTATTAATCCTTCGCTAGGAAAAAATGTCTCATTTATGATTGGAATCATTTGTGGAGGACTT
ATATTTGGAACCGTAGCAGGATTTATTTCTATGGTCCCTTATATGATGAAAGATGTCTATCAATTAAGTACTGCTGCAAT
TGGAAGTGGGATTATTTTTCCTGGGGCAATGAGTGTTATTGTTTTCGGTTATATTGGGGGATTGCTTGTTGATAAGAAAG
GTTCACTATTTGTATTAACAACTGGAGTTGCATTTCTTTCTATAAGCTTTTTAGTAGCTGCCCTTTTTATAGAAACAACG
CCTTGGCTTATAACAATTATATTAATTTTTGTTTTTGGGGGGCTTTCTTTTACGAAAACAGTTATATCCACCATTGTTTC
AAGTAGTTTGGAACAAAAGGAAGCTGG