MEGAResFrom MEG, the Microbial Ecology Group

TET43

The tet43 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>107|unknown_id|unknown_name|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET43
ATGCCCCCATCTCACCACATGTTGCGCCCAATCGAACAATGTTCTATTCTATGGAACGACGTTCGATACTCGAACAGCGT
TCGACTGAAGGAGGCCGGTATGACCGCCACAACTCAAGCCTCGGCACCCGCGGCACGTACCTATCTGTCGCTGCGCGCCG
CGTGGATTCCGCTCTTCGCGCTCTGCCTCGCGTTCTTCGTGGAGATGGTTGACAACACCCTGCTCACGATCGCGCTGCCG
ACGATCGGGCGCGACCTCGGCGCGAGCGTCACCTCCTTGCAGTGGGTGACCGGCGCCTATTCGCTGACCTTTGGCGGCCT
GTTGCTGACAGCGGGCTCGCTCGCCGACCGCTTTGGCCGGCGCCGCGTGCTGCAGATTGGCCTTCTCGCCTTTGGGCTCA
TCAGCCTCACGGTGATTGCCGTGGCAACCGCGGGCCAGCTGATCGCGGTGCGCGCTGCGCTCGGCCTCGCCGCCGCCGCG
ATGGCCCCAATCACCAACTCCCTCGTGTTCAGGCTGTTCGAGGGCGAGGACCTCCGTCGGCGGGCAATGACCCTCATGAT
CGTCGTCGGCATGAGCGGATTCATCCTTGGCCCGCTACTCGGCGGAACGGTTCTCGCTCACGCCAGCTGGCAGTGGTTGC
TGCTTATCAACGCACCCATCGCGCTCATTGCGCTCATCGGCGTTCGCCTTGGCGTGCCTGCGGACGACGCCGAGGGACTC
ACAAAGGACCGCCTTGACGTGAAGGGCTCGGCACTCAGCATCGCCGCGATCGGCCTCGCTTGCTACACACTCACGAGCGG
AGTGGAGCACGGCTGGATGTCTGCCGTCACCTGGGCCTGCGGGATCGGCGCGGCTGCCGCGCTGATGGGATTCGTGTGGC
ACGAGCGCCGCACCGATCACCCCATGCTGGACCTCGACGTCTTCAGGAACCGCACCGTTCGCGGCGCATCGATCGCCCAG
GTAGGCACCTCAATCGCGATGGCTTCGCTGATGTTCGGCCTGATCCTTCACTTCCAGGGCGCGTACGGCTGGAGCCCCAT
GCGCGCCGGCCTCGCCAACCTGCCGCTCATCCTCACGATGATTCTTGCGACACCGGTCTCTGAGGGCCTCGCGAAGAGGT
TCGGCCACCGCATTGCCATGCTCATCGGCGCGGGTCTCCTCGCCGGATCGCTCGCTGGCCTCGCGTGGGGCGTGGGGCAT
GGSTACCTCGTCATCGCGGTATTCATGGTGACCTTCACCCTCGGTCTCCGCACCGTTATGACGATCGCGGCGGTGGGCCT
CGTTGGTGCGATGCCGGAGAACCGCACCTCGCTCGGCGCGGCACTCAACGACACCGCCCAAGAAGTAGGAACAAGCCTCG
GCATGGCAGTGATCGGCACGCTCATCGCGGTGCTCGYCACCACGACGCTTCCCAACGGCGACKGGAGCCTCGACCTCGCG
ACTTCATACTTCGCCGGGGAGCGCATCGCTTATCTGTTCCTTGCCGTCGTAGTCGGAGTGATCGCGGGATGGGGCGCGCT
CACGTTGTCCAACTCCAAGGAGATGGAAGACGTCCACTAG

>CARD|phgb|GQ244501|59-1619|ARO:3000573|tet43|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET43
CTAGTGGACGTCTTCCATCTCCTTGGAGTTGGACAACGTGAGCGCGCCCCATCCCGCGATCACTCCGACTACGACGGCAA
GGAACAGATAAGCGATGCGCTCCCCGGCGAAGTATGAAGTCGCGAGGTCGAGGCTCCMGTCGCCGTTGGGAAGCGTCGTG
GTGRCGAGCACCGCGATGAGCGTGCCGATCACTGCCATGCCGAGGCTTGTTCCTACTTCTTGGGCGGTGTCGTTGAGTGC
CGCGCCGAGCGAGGTGCGGTTCTCCGGCATCGCACCAACGAGGCCCACCGCCGCGATCGTCATAACGGTGCGGAGACCGA
GGGTGAAGGTCACCATGAATACCGCGATGACGAGGTASCCATGCCCCACGCCCCACGCGAGGCCAGCGAGCGATCCGGCG
AGGAGACCCGCGCCGATGAGCATGGCAATGCGGTGGCCGAACCTCTTCGCGAGGCCCTCAGAGACCGGTGTCGCAAGAAT
CATCGTGAGGATGAGCGGCAGGTTGGCGAGGCCGGCGCGCATGGGGCTCCAGCCGTACGCGCCCTGGAAGTGAAGGATCA
GGCCGAACATCAGCGAAGCCATCGCGATTGAGGTGCCTACCTGGGCGATCGATGCGCCGCGAACGGTGCGGTTCCTGAAG
ACGTCGAGGTCCAGCATGGGGTGATCGGTGCGGCGCTCGTGCCACACGAATCCCATCAGCGCGGCAGCCGCGCCGATCCC
GCAGGCCCAGGTGACGGCAGACATCCAGCCGTGCTCCACTCCGCTCGTGAGTGTGTAGCAAGCGAGGCCGATCGCGGCGA
TGCTGAGTGCCGAGCCCTTCACGTCAAGGCGGTCCTTTGTGAGTCCCTCGGCGTCGTCCGCAGGCACGCCAAGGCGAACG
CCGATGAGCGCAATGAGCGCGATGGGTGCGTTGATAAGCAGCAACCACTGCCAGCTGGCGTGAGCGAGAACCGTTCCGCC
GAGTAGCGGGCCAAGGATGAATCCGCTCATGCCGACGACGATCATGAGGGTCATTGCCCGCCGACGGAGGTCCTCGCCCT
CGAACAGCCTGAACACGAGGGAGTTGGTGATTGGGGCCATCGCGGCGGCGGCGAGGCCGAGCGCAGCGCGCACCGCGATC
AGCTGGCCCGCGGTTGCCACGGCAATCACCGTGAGGCTGATGAGCCCAAAGGCGAGAAGGCCAATCTGCAGCACGCGGCG
CCGGCCAAAGCGGTCGGCGAGCGAGCCCGCTGTCAGCAACAGGCCGCCAAAGGTCAGCGAATAGGCGCCGGTCACCCACT
GCAAGGAGGTGACGCTCGCGCCGAGGTCGCGCCCGATCGTCGGCAGCGCGATCGTGAGCAGGGTGTTGTCAACCATCTCC
ACGAAGAACGCGAGGCAGAGCGCGAAGAGCGGAATCCACGCGGCGCGCAGCGACAGATAGGTACGTGCCGCGGGTGCCGA
GGCTTGAGTTGTGGCGGTCATACCGGCCTCCTTCAGTCGAACGCTGTTCGAGTATCGAACGTCGTTCCATAGAATAGAAC
ATTGTTCGATTGGGCGCAACATGTGGTGAGATGGGGGCATG