MEGAResFrom MEG, the Microbial Ecology Group

TET41

The tet41 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>CARD|phgb|AY264780|1824-3006|ARO:3000569|tet41|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET41
TTATGGCGCCGCATCCCTGGCGCGTGAGCGTGCCAGCAGCGGCGGCACCACCAGGTACAGGGCGGCGGCCAACGCCCACA
CCAGCCCAGGCCAGACATCGCGCGTGGCGGCATACAGCGCCGTCGCCACCAGCGGCCCCGCGACGCCGATCAGGCTGCCC
ATGCTGGCGAGCGTCCCTTGCAGCTCGCCCTGATGATCGTCGTCCACCTTGTGCGCCATCAGCGCCTGCAGTGCGGGCAA
CGCCATGCCGCCCGCGGCGAAGAACGGCAGCAGGGCGAACGGCGCCCAGCCGCGCGTGGCGACAGACAACAGCGCCAGGC
CCACGGCGTCGGCGGCCAGGCCGATCAGCAGCGCCTTGCGCTCGCCGAGCCGCGCGACCAGCGGGCCGATGGCAAAGGCC
TGCGACAGCGCGTGGCAGGCGCCGTAGCCGGCCAGCGACAGGCCCGCCACCATCATGCTCCAGCCGAAACGATCCTGACC
GTATAAAATCCACAGCGTGGCCGGCGCCTGCGAAACCAGCGCCATAACCAGATAAATGCCGGCCAGCGGCAGCAGGCCAG
GCTTGCCGTGCAGCCGGCGCAATGACGAGAAGGGATTAAGGCGAATTTTCTCGGCGGCGCGGGGGCGGGATTTACGCGAT
TCGGGCAGCAGGAAAAACGCCATCACCAGGTTGAGGGCATTCATCATCGCCGCCGCCAGGAAGGGCGCATGCAGATGCCA
TTCGCCCAGCGATCCGCCGAGCAGCGGGCCGACGATAAAGCCGACGCCGAACACCGCGCCCACCAGGCCGAAACGCCGAG
CGCGCTGGCCGACGGGGGTAATATCGGTGACGTAAGCGGTGGCGACCGCCATGTTGGCGCCGGTGATGCCCGCCAGCAAC
CGCCCCAGATAGAGCCAGGCCAGCGTCGGCGCGAACGCCATCAGCAGGTAGTCGGCCGCCGCGCCGGCGAGCGAAATCAA
CAGCACCGGCCGCCGCCCGAAACGATCGCTCAGCGCGCCGAGGATCGGCGAAAACAGGAATTGCATCAACGCATAGGCCG
CCAGCAGGGCGCCGTAATGCACGCTGCCGGCATCGAGACCGCCCAGCGAGCGCAACAGCGCCGGTAGAATAGGCATGATC
AGACCGATGCCCACCGCATCCAGCAACACCGTCAACAAAATAACCAGCATGGGTTTTTTCAAA