MEGAResFrom MEG, the Microbial Ecology Group

TET39

The tet39 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tet39_2_EU495991|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET39
CACTAATACCTCTGGACATCATTGCTTGCAAAGCAGGAACGGCTACTCCACCAAGGGCAAACAATGGTAACAACGCAAAA
GGCACCCATTCTTCAACAGCAATAGATAAAAGAAGTAAACCAATTGCATCGCAAGCTATTCCACATAACAACGTATTTTT
CTCTCCAAACCTCTTTACCATAGGGGCGATAGCAAAAGCCTGTGCAATAGAATGGCATATTCCATAACTAGCAAGGGAAA
CACCTGCAATAAATATACTCCAGCCATAACGATCCTGCCCATAGATAACCCATAAAGTTGCGGGGACTTGTGAAACCAAT
GTGATAATTAAAAAGATACCAAGCAATGGAGCCATATTAGGTTGAGTGATCAAATAGGATAATTTCTTTAATATTGATTG
CTCCTGAACCTTCTCAGTCATTTTATTGCTGTGTTTTGATTCTTTTAATAAGACTGCTGTCATTATTAAATTAATCCCAT
TCATAAAAGCAGCAGCAAAGAACGGTGCATGTAAGTTCCATTCACCCAAAACTCCACCTATTACCGGACCCGCTATAAAC
CCAATACCAAAGACAGCTCCAAGGAGACCAAACCTTTTTGCACGCTCATGGGCTGGAGTAATATCTGAAACATAAGCTGT
TGCAACAGCCATGTTGGCACCTGTAATTCCCGCAAAAATACGACCAATATATAGCCACAATAGAGAAGGAG

>Tet|tet39_3_DQ195075|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET39
AATTGGTCGTATTTTTGCGGGAATTACAGGTGCCAACATGGCTGTTGCAACAGCTTATGTTTCAGATATTACTCCAGCCC
ATGAGCGTGCAAAAAGGTTTGGTCTCCTTGGAGCTGTCTTTGGTATTGGGTTTATAGCGGGTCCGGTAATAGGTGGAGTT
TTGGGTGAATGGAACTTACATGCACCGTTCTTTGCTGCTGCTTTTATGAATGGGATTAATTTAATAATGACAGCAGTCTT
ATTAAAAGAATCAAAACACAGCAATAAAATGACTGAGAAGGTTCAGGAGCAATCAATATTAAAGAAATTATCCTATTTGA
TCACTCAACCTAATATGGCTCCATTGCTTGGTATCTTTTTAATTATCACATTGGTTTCACAAGTCCCCGCAACTTTATGG
GTTATCTATGGGCAGGATCGTTATGGCTGGAGTATATTTATTGCAGGTGTTTCCCTTGCTAGTTATGGAATATGCCATTC
TATTGCACAGGCTTTTGCTATCGCCCCTATGGTAAAGAGGTTTGGAGAGAAAAATACGTTGTTATGTGGAATAGCTTGCG
ATGCAATTGGTTTACTTCTTTTATCTATTGCTGTTGAAGAATGGGTGCCTTTTGCGTTGTTACCATTGTTTGCCCTTGGT
GGAGTAGCCGTTCCTGCTTTGCAAGCAATGATGTCA

>249|AY743590.1|AY743590|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET39
GTGAAGAAATCATTGAGCGTGATTTTAATCACTATATTTCTGGATGCTGTTGGGATTGGTTTAATTATGCCGATCTTGCC
TGAATTATTACGGTCATTGGCTGGAGCTGAAGCAGGCGGTGTTCACTATGGTGCTTTATTAGCTGTGTATGCTCTGATGC
AGTTCATTTTTGCACCTATCCTTGGAGCGTTGAGTGACCGATTTGGACGTCGACCTGTATTAATTATTTCAATTGCTGGT
GCAACGGCTGATTATCTCCTAATGGCTGCTGCTCCTTCTCTATTGTGGCTATATATTGGTCGTATTTTTGCGGGAATTAC
AGGTGCCAACATGGCTGTTGCAACAGCTTATGTTTCAGATATTACTCCAGCCCATGAGCGTGCAAAAAGGTTTGGTCTCC
TTGGAGCTGTCTTTGGTATTGGGTTTATAGCGGGTCCGGTAATAGGTGGAGTTTTGGGTGAATGGAACTTACATGCACCG
TTCTTTGCTGCTGCTTTTATGAATGGGATTAATTTAATAATGACAGCAGTCTTATTAAAAGAATCAAAACACAGCAATAA
AATGACTGAGAAGGTTCAGGAGCAATCAATATTAAAGAAATTATCCTATTTGATCACTCAACCTAATATGGCTCCATTGC
TTGGTATCTTTTTAATTATCACATTGGTTTCACAAGTCCCCGCAACTTTATGGGTTATCTATGGGCAGGATCGTTATGGC
TGGAGTATATTTATTGCAGGTGTTTCCCTTGCTAGTTATGGAATATGCCATTCTATTGCACAGGCTTTTGCTATCGCCCC
TATGGTAAAGAGGTTTGGAGAGAAAAATACGTTGTTATGTGGAATAGCTTGCGATGCAATTGGTTTACTTCTTTTATCTA
TTGCTGTTGAAGAATGGGTGCCTTTTGCGTTGTTACCATTGTTTGCCCTTGGTGGAGTAGCCGTTCCTGCTTTGCAAGCA
ATGATGTCCAGAGGTATTAGTGATGAAAGACAAGGTGAATTACAAGGGCTATTAAGCAGTTTTAATAGTCTGGGGGCTAT
AATTGGTCCTGTATTAGTTACTAGCCTCTATTTTATGACTCAGGCATCAGCTCCTGGAATGGTATGGGCATTAGCTGCAA
TACTTTATGTAATCACCCTACCCTTATTGCTTAAGTATCGCCTGAATAAATATTCTGGAGTTCCATAA