MEGAResFrom MEG, the Microbial Ecology Group

TET38

The tet38 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tet38_3_FR821779|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET38
ATGAATGTTGAATATTCTAAAATAAAGAAAGCAGTACCTATTTTACTATTCTTATTTGTATTCAGTTTGGTTATAGACAA
CTCATTTAAATTGATTTCTGTAGCCATTGCTGATGACTTAAACATTTCTGTAACGACAGTAAGTTGGCAAGCGACATTAG
CCGGTTTAGTAATTGGTATTGGCGCTGTAGTATACGCTTCATTATCTGATGCCATTAGTATACGCACACTATTTATTTAT
GGCGTGATATTAATCATTATCGGATCAATTATTGGTTACATTTTCCAACATCAATTCGCATTACTTTTAGTTGGACGTAT
TATTCAAACTGCAGGTTTAGCTGCTGCAGAGACATTATATGTGATATATGTTGCAAAGTATCTTTCTAAAGAGGACCAGA
AGACTTACCTTGGCTTAAGTACGAGCAGTTATTCCTTGTCATTAGTTATCGGTACATTATCAGGTGGATTTATTTCTACG
TATTTACACTGGACAAATATGTTTTTAATTGCGTTAATCGTAGTATTTACGTTGCCATTCCTATTTAAATTATTACCAAA
AGAAAATAATACAAATAAAGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATCGCTACAACAGTCATGCTGT
TTATTACGAACTTTAATTGGTTATATATGATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCT
CAACGTCCATTAGTAAACAAATCATTTTTCCAAAATAAACGTTATGCTTCATTTTTATTTATAGTATTTGTAATGTATGC
CATCCAATTGGGTTATATTTTTACGTTCCCATTCATAATGGAACAAACTTATCATCTTCAACTAGACACAACATCACTGT
TATTAGTACCGGGTTATATTGTAGCAGTCATCGTTGGTGCACTAAGTGGTAAAATCGGCGAATATCTTAATTCAAAACAA
GCGATTATCACAGCAATTATTTTAATCGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTT
CGTCATTTCTATGATATTCTTTGCAGGTAGCTTTGCTTTAATGTATGCACCTTTACTTAACGAAGCCATTAAAACAATAG
ATCTTAATATGACAGGTGTGGCTATTGGTTTTTATAATTTAATTATTAATGTGGCGGTATCTGTAGGTATTGCGATTGCT
GCGGCTCTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTAAGTTCACATTTCGGTATTATTTTAATTAT
TTTAGGTTTAATGAGTATTGTCGGATTAGTTTTATTCGTCATCTTAAATCGTTGGACACAATCTGAAAAATAA

>Tet|Tet-38|AY825285|1-1353|1353|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET38
ATGAATGTTGAATATTCTAAAATAAAGAAAGCAGTACCTATTTTATTATTCTTATTTGTATTCAGTTTGGTTATAGACAA
CTCATTTAAATTGATTTCTGTAGCCATTGCTGATGACTTAAACATATCTGTAACGACAGTAAGTTGGCAAGCGACATTAG
CCGGTTTAGTAATTGGTATTGGCGCTGTAGTATACGCTTCATTATCTGATGCCATTAGTATACGCACACTATTTATTTAT
GGCGTGATATTAATCATTATCGGATCAATTATTGGTTACATTTTCCAACATCAATTCCCATTACTTTTAGTTGGACGTAT
TATTCAAACTGCCGGTTTAGCTGCTGCAGAGACATTATATGTGATATATGTTGCAAAGTATCTTTCTAAAGAGGACCAGA
AGACTTACCTTGGCTTAAGTACGAGCAGTTATTCCTTGTCATTAGTTATCGGTACATTATCAGGTGGATTTATTTCTACG
TATTTACACTGGACAAATATGTTTTTAATTGCATTAATCGTAGTATTTACGTTGCCATTCCTATTTAAATTATTACCAAA
AGAAAATAATACGAATAAAGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATTGCTACAACAGTCATGCTGT
TTATTACGAACTTTAATTGGTTATATATGATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCG
CAACGTCCATTAGTAAATAAATCATTTTTCCAAAATAAACGTTATGCTTCATTTTTATTTATAGTATTTGTAATGTATGC
TATCCAATTGGGTTATATTTTTACGTTCCCATTCATAATGGAGCAAATTTATCATCTGCAACTAGACACAACATCACTGT
TATTAGTACCGGGTTATATAGTAGCAGTCATTGTTGGTGCATTAAGTGGTAAAATCGGCGAATATCTGAATTCAAAACAA
GCGATTATCACAGCAATTATTTTAATAGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTT
CGTCATTTCTATGATATTCTTTGCAGGTAGCTTTGCTTTAATGTATGCACCTTTACTTAACGAAGCCATTAAAACAATAG
ATCTTAATATGACAGGTGTGGCTATTGGTTTTTATAATTTAATTATTAATGTGGCGGTATCTGTAGGTATTGCGATTGCT
GCGGCTCTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTAAGTTCACATTTCGGTATTATTTTAATTAT
TTTAGGTTTAATGAGTATTGTCGGATTAGTTTTATTCGTCATCTTAAATCGTTGGACACAATCTGAAAAATAA

>Tet|tet38_2_FN433596|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET38
ATGAATGTTGAATATTCTAAAATAAAGAAAGCAGTACCTATTTTATTATTCTTATTTGTATTCAGTTTGGTTATAGACAA
CTCATTCAAATTGATTTCTGTAGCCATTGCTGATGACTTAAACATTTCAGTAACGACAGTAAGTTGGCAAGCGACATTAG
CCGGTTTAGTAATTGGTATTGGCGCTGTAGTATACGCTTCATTATCTGATGCCATTAGTATACGCACACTATTTATTTAT
GGCGTGATATTAATCATTATCGGATCAATTATTGGTTACATTTTCCAACATCAATTCGCATTACTTTTAGTTGGACGTAT
TATTCAAACTGCAGGTTTAGCTGCTGCAGAGACATTATATGTGATATATGTTGCAAAGTATCTTTCTAAAGAGGACCAGA
AGACTTACCTTGGCTTAAGTACGAGCAGTTATTCCTTGTCATTAGTTATCGGTACATTATCAGGTGGATTTATTTCTACG
TATTTACACTGGACAAATATGTTTTTAATTGCATTAATCGTAGTATTTACGTTGCCATTCCTATTTAAATTATTACCAAA
AGAAAATAATACAAATAAAGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATCGCTACAACAGTTATGCTGT
TTATTACGAACTTTAATTGGATATATATGATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCG
AAACGTCCATTAGTAAACAAATCATTTTTCCAAAATAAACGTTATGCTTCATTTTTATTTATAGTATTTGTAATGTATGC
CATCCAATTGGGTTATATTTTTACGTTCCCATTCATAATGGAACAAATTTATCATCTTCAGCTAGACACAACATCACTGC
TATTAGTACCGGGTTATATTGTAGCAGTCATCGTTGGTGCACTAAGTGGTAAAATCGGCGAATATCTTAATTCAAAACAA
GCGATTATCACAGCAATTATTTTAATCGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTT
CGTCATTTCTATGATATTCTTTGCAGGTAGCTTTGCTTTAATGTATGCACCTTTACTTAACGAAGCCATTAAAACAATAG
ATCTTAATATGACAGGTGTGGCTATTGGTTTTTATAATTTAATTATTAATGTGGCGGTATCTGTAGGTATTGCGATTGCT
GCGGCTTTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTAAGTTCACATTTCGGTATTATTTTAATTAT
TTTAGGTTTAATGAGTATTGTCGGATTAGTTTTATTCGTCATCTTAAATCGTTGGACACAATCTGAAAAATAA