MEGAResFrom MEG, the Microbial Ecology Group

TET35

The tet35 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>304|unknown_id|unknown_name|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET35
ATGTGTGTGATCATGCCAGCTTCTAGTTGGGGTGCGTACATCATTACCATCATCGGTGGTATCTTGGTGTCACACGGCAT
CACTGAATACTCGGCGCTTGGTGCTTACGTTCGTCTTATTCCTATGAACTTCTACGCAGTATTTGCTCTACTAATGGTAT
TTGCAGTGGCGTGGTTTGGTCTAGATATCGGTAAGATGCGTGAACATGAAATCGCAGCATCTCAAGGCCGTGGTTTTGAT
AAAGATAAAGAGAACGACTCACAAGAAGCACACGACCTAAACGAAGAGCTAGATATTCGTGAAAGCGAGAAGGGTAAGGT
TTCTGACCTAATTCTTCCTATCGTAACGCTTATTGTGGCGACTATTGCTTCAATGCTTTACACCGGTGGTCAAGCGCTAG
CAGCAGATGGTAAAGAATTTGTGCTGTTGGGTGCGTTTGAAAACACGGATGTTGGTACTTCTCTAATCTACGGTAGTTTA
CTTGGTCTAGCAGTTGCATTGTTCACTGTTATTAAGCAAGGTCTACCAATGGTTGAGATTGCACGCACGCTTTGGATTGG
TGCTAAGTCAATGTTTGGTGCAATCCTTATCCTTGTTTTCGCTTGGACTATTGGTTCAGTTATCGGTGACATGAAGACGG
GTTCTTACCTATCTACAATGGCGCAAGGCAACATCAACCCACACTGGCTACCAGTTATCCTGTTCTTGCTGTCTGGCCTA
ATGGCGTTCTCTACAGGTACGTCATGGGGTACGTTCGGTATCATGCTTCCAATCGCGGGTGACATGGCTGGCGCAACAGA
CGTGGCACTAATGCTACCAATGCTAAGTGCGGTTCTAGCTGGTGCAGTATTTGGTGACCACTGTTCACCAATTTCAGATA
CAACGATTCTGTCGTCAACAGGTGCACGCTGTAACCACATCGATCACGTATCGACGCAGCTACCTTATGCATTATCAGTG
GCGTTTGTGTCATGTATTGGCTTTATCACGCTGGGTATGACTGCATCGATCGCGTTCTCTTTCATCGCAGCATCGATCAC
TTTCGTTATCGTTTGTGCGATTCTGTCGTGGCTGTCGAAGTCTAAAATGGCATCCTGCCAGAACGCGTAG

>CARD|phgb|AF353562|0-1110|ARO:3000481|tet35|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET35
CTACGCGTTCTGGCAGGATGCCATTTTAGACTTCGACAGCCACGACAGAATCGCACAAACGATAACGAAAGTGATCGATG
CTGCGATGAAAGAGAACGCGATCGATGCAGTCATACCCAGCGTGATAAAGCCAATACATGACACAAACGCCACTGATAAT
GCATAAGGTAGCTGCGTCGATACGTGATCGATGTGGTTACAGCGTGCACCTGTTGACGACAGAATCGTTGTATCTGAAAT
TGGTGAACAGTGGTCACCAAATACTGCACCAGCTAGAACCGCACTTAGCATTGGTAGCATTAGTGCCACGTCTGTTGCGC
CAGCCATGTCACCCGCGATTGGAAGCATGATACCGAACGTACCCCATGACGTACCTGTAGAGAACGCCATTAGGCCAGAC
AGCAAGAACAGGATAACTGGTAGCCAGTGTGGGTTGATGTTGCCTTGCGCCATTGTAGATAGGTAAGAACCCGTCTTCAT
GTCACCGATAACTGAACCAATAGTCCAAGCGAAAACAAGGATAAGGATTGCACCAAACATTGACTTAGCACCAATCCAAA
GCGTGCGTGCAATCTCAACCATTGGTAGACCTTGCTTAATAACAGTGAACAATGCAACTGCTAGACCAAGTAAACTACCG
TAGATTAGAGAAGTACCAACATCCGTGTTTTCAAACGCACCCAACAGCACAAATTCTTTACCATCTGCTGCTAGCGCTTG
ACCACCGGTGTAAAGCATTGAAGCAATAGTCGCCACAATAAGCGTTACGATAGGAAGAATTAGGTCAGAAACCTTACCCT
TCTCGCTTTCACGAATATCTAGCTCTTCGTTTAGGTCGTGTGCTTCTTGTGAGTCGTTCTCTTTATCTTTATCAAAACCA
CGGCCTTGAGATGCTGCGATTTCATGTTCACGCATCTTACCGATATCTAGACCAAACCACGCCACTGCAAATACCATTAG
TAGAGCAAATACTGCGTAGAAGTTCATAGGAATAAGACGAACGTAAGCACCAAGCGCCGAGTATTCAGTGATGCCGTGTG
ACACCAAGATACCACCGATGATGGTAATGATGTACGCACCCCAACTAGAAGCTGGCATGATCACACACAT