MEGAResFrom MEG, the Microbial Ecology Group

TET33

The tet33 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>1374|DQ077487.1|DQ077487|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET33
CTGATCGCGCTCTACGCGGTAATGCAGTTCATCTTTGCCCCCGTACTGGGAACACTGTCGGACCGATTCGGCCGCCGCCG
GGTGCTGCTTGTTTCCCTGGCCGGTGCGACCGTCGACTATCTCGTGCTCGCCACGACATCCGCTCTGTCGGTGTTCTATA
TCGCCCGTGCAGTGGCTGGGATAACCGGAGCGACCAATGCGGTCACCGCCACCGTGATCGCCGACATCACGCCACCCCAC
CAGCGCGCCAAGCGTTTCGGTTTACTCAGTGCCTGCTATGGCGGCGGAATGATCGCGGGGCCAGCCATGGGTGGACTGTT
CGGTGCCATCTCGCCACATCTGCCGTTTTTGCTCGCTGCTCTTCTCTCAGCGAGCAATCTGGCACTCACCTTTATCCTGT
TACGCGAGACCCGTCCTGATTCCCCTGCGCGCTCTGCGTCGCTCGCTCAGCATCGTGGTCGCCCCGGCCTCAGCGCGGTG
CCTGGGATTACCTTCCTATTAATCGCATTCGGCCTTGTTCAATTCATTGGGCAGGCTCCAGGTGCGACCTGGGTGCTGTT
TACTGAACACCGCCTCGACTGGAGTCCCGTCGAAGTTGGAATCTCCCTGTCCGTTTTCGGGATCGTACAGGTTCTCGTGC
AGGCCCTCCTTACTGGCCGCATCGTGGAGTGGATCGGTGAGGCAAAAACAGTCATCATCGGGTGTATTACCGACGCCTTG
GGTCTCGTAGGCCTGGCG

>Tet|tet33_3_DQ390458|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET33
TCACATCGAGTCGCCGCTCGCCCAAGAGCCGAACTTCGGGGACGCTGCTGTACCACGCATGATGAGAATCACGCAGGGCA
CGTAGAGTGCTGCGGCGCAGAGCCAGAGGAAGCCGTCGGCGTTGATGTAAGTGAGCGCGAAGATCGTTGTGAAAGCGACC
GGTCCGAAGATCGATGTGATGCTGTTGATCCTGGCGAGCACACCCTGGAGGCGCCCTTGGTGCTGTTCATCGACGCGCTG
GGAGAGAAGGGTTTGCAGAGCGGGGAGGCCGATGCCACCGATCCCGAGTGCCGCCAAGATAGGCGCCATGGAAAATGCGT
CAGTGACAATCGCCAGGCCTACGAGACCCAAGGCGTCGGTAACACACCCGATGATGACTGTTTTTGCCTCACCGATCCAC
TCCACGATGCGGCCAGTAAGGAGGGCCTGCACGAGAACCTGTACGATCCCGAAAACGGACAGGGAGATTCCAACTTCGAC
GGGACTCCAGTCGAGGCGGTGTTCAGTAAACAGCACCCAGGTCGCACCTGGAGCCTGCCCAATGAATTGAACAAGGCCGA
ATGCGACTAATAGGAAGGTAATCCCAGGCACCGCGCTGAGGCCGGGGCGACCACGATGCTGAGCGAGCGACGCAGAGCGC
GCAGGGGAATCAGGACGGGTCTCGCGTAACAGGATAAAGGTGAGTGCCAGATTGCTCGCTGAGAGAAGAGCAGCGAGCAA
AAACGGCAGATGTGGCGAGATGGCACCGAACAGTCCACCCATGGCTGGCCCCGCGATCATTCCGCCGCCATAGCAGGCAC
TGAGTAAACCGAAACGCTTGGCGCGCTGGTGGGGTGGCGTGATGTCGGCGATCACGGTGGCGGTGACCGCATTGGTCGCT
CCGGTTATCCCAGCCACTGCGCGGGCGATATAGAACACCGACAGAGCGGACGTCGTGGCGAGCACGAGATAGTCCACGGT
CGCACCGGCCAGGGAAACAAGCAGCACCCGGCGGCGGCCGAATCGGTCCGACAGCGTTCCCAGTACGGGGGCAAAGATGA
ACTGCATTACCGCGTAGAGCGCGATCAGCACTCCGACGTTCAGCGGAACCGCATCAGCGGTGACCCCTGCCTCGTGTAGC
AGTGCGGGAAGAATCGGCATCACCAGGCCCATGCCGGCGGCGTCGAGGCTAGCCGTGATGAGGACCGTGGCCAACGAGCC
ACGAGCGGAAGTGAGAAATGACACCTTATCAACGATAAAGTTATCGATGATAAAGTGCAA

>Tet|Tet-33|AJ420072|22940-24163|1224|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET33
GTGTCATCTCTCACTTCCGCTCGTGGCTCGTTGGCCACGGTCCTCATCACGGCTAGCCTCGACGCCGCCGGCATGGGCCT
GGTGATGCCGATTCTTCCCGCACTGCTACACGAGGCAGGGGTCACCGCTGATGCGGTTCCGCTGAACGTCGGAGTGCTGA
TCGCGCTCTACGCGGTAATGCAGTTCATCTTTGCCCCCGTACTGGGAACGCTGTCGGACCGATTCGGCCGCCGCCGGGTG
CTGCTTGTTTCCCTGGCCGGTGCGACCGTCGACTATCTCGTGCTCGCCACGACGTCCGCTCTGTCGGTGTTCTATATCGC
CCGCGCAGTGGCTGGGATAACCGGAGCGACCAATGCGGTCACCGCCACCGTGATCGCCGACATCACGCCACCCCACCAGC
GCGCCAAGCGTTTCGGTTTACTCAGTGCCTGCTATGGCGGCGGAATGATCGCGGGGCCAGCCATGGGTGGACTGTTCGGT
GCCATCTCGCCACATCTGCCGTTTTTGCTCGCTGCTCTTCTCTCAGCGAGCAATCTGGCACTCACCTTTATCCTGTTACG
CGAGACCCGTCCTGATTCCCCTGCGCGCTCTGCGTCGCTCGCTCAGCATCGTGGTCGCCCCGGCCTCAGCGCGGTGCCTG
GGATTACCTTCCTATTAATCGCATTCGGCCTTGTTCAATTCATTGGGCAGGCTCCAGGTGCGACCTGGGTGCTGTTTACT
GAACACCGCCTCGACTGGAGTCCCGTCGAAGTTGGAATCTCCCTGTCCGTTTTCGGGATCGTACAGGTTCTCGTGCAGGC
CCTCCTTACTGGCCGCATCGTGGAGTGGATCGGTGAGGCAAAAACAGTCATCATCGGGTGTATTACCGACGCCTTGGGTC
TCGTAGGCCTGGCGATTGTCACTGACGCATTTTCCATGGCACCTATCTTGGCGGCACTGGGGATCGGTGGCATCGGCCTC
CCCGCTCTGCAAACCCTTCTCTCCCAGCGCGTCGATGAACAGCACCAAGGGCGCCTCCAGGGTGTGCTCGCCAGCATCAA
CAGCGTCACATCGATCTTCGGACCGGTCGCTTTCACAACGATCTTCGCGCTCACTTACATCAACGCCGACGGCTTCCTCT
GGCTCTGCGCCGCAGCACTCTACGTGCCCTGCGTGATTCTCATCATGCGTGGTACAGCAGCGTCCCCGAAGTTCGGCTCT
TGGGCGAGCGGCGACTCGATGTGA