MEGAResFrom MEG, the Microbial Ecology Group

TET31

The tet31 gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|Tet-31|AJ250203|1651-2883|1233|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET31
ATGATAGGGAAGCTTATAATGATGAATCGCTATATCACAATCGCCCTCTTAATTACCTTCCTAGATGCAACAGGAATGGG
CTTAATCATGCCTGTATTACCAACACTTTTAGAAGAGTTCTCTGTCAAAGAGTCTATCGCCACTCATTATGGTTTTATCC
TCGCAATCTATGCGCTGATGCAAGTTATTTTTGCACCAATATTAGGACAACTCTCGGATAAATTTGGCAGAAAACCGGTC
TTGATTCTCTCATTAATAGGCGCTGTTTGTGATTACACCCTACTCTCATTTTCTAGCGCCTTATGGATGCTCTATCTAGG
GAGAATGATTGCCGGCATTTCTGCTGCAACAGGAGCCGTAGCAGCATCAATGGTCGCAGATCACACAAAAAAAGCAGAGA
GAACTAAATGGTTTGGAAAGTTAGGCGCAGCTTTTGGGGCGGGACTCATTGCCGGACCCGCTATTGGTGGATTTATCGGA
CAATATTCTGCACATTTCCCCTTTATCATTGCCGCAATTTTAAATGCCATTGCTCTTATCATGGTCATTATCCTCTTCCC
TAAAGAGCAATCACGCCCAAAAGAAATCGAGCAAGATCAATCTAAAATTCATGAAAAAACCACCATCAATGCCCCGCTAA
TTCATATTCTCAAACCCGTTTTGCTACTTCTCATGCTGTTTTTTACAGTACAACTCATCGGACAAATCCCTGCATCAACT
TGGGTTCTATTTACTGAGTACCGTTTTGAGTGGAATACCTTTAACATTGGTTTATCCCTTGCAGGGCTAGGGTTAATGCA
TATTATCTTTCAGGCTTTTGTCGCAGGATATATCGCATCTCGCTGGAAAAATGAAACCGTATTTATTCTCGGATTTATAC
TAGATGCGAGCGCATTCTTATTACTGGCCTTTATCTCTCAAGTTTGGCTGGTAATTCCTACATTGATCTTATTAGCAGGA
GGAGGCATCGCCTTACCGGCATTACAAGGATTAATCTCTATAAAGACAGCAGATGAACATCAAGGAAAGATACAAGGTAT
CATGGTTAGCCTCACTAATATTACCGGAATAATTGGACCGCCCATTTTTGCATTTTCCTTTGCAAAAACGGTTACAAACT
GGGATGGCACACTTTGGCTAATCGGTGCTGTACTCTATAGCATTTTATTAGGTCTCTATTTTCTCTATCAAAAGATACGC
GCCTATAAACAACTTAAGTCTCAAACTGCTTAA

>Tet|tet31_1_GQ283908|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TET31
ATGATAGGGAAACTTATAATGATGAATCGCTATATCACAATCGCCCTCTTAATTACCTTCCTAGATGCAACAGGAATGGG
CTTAATCATGCCTGTATTACCAACACTTTTAGAAGAGTTCTCTGTCAAAGAGTCTATCGCCACTCATTATGGTTTTATCC
TCGCAATCTATGCGCTGATGCAAGTTATTTTTGCACCAATATTAGGACAACTCTCGGATAAATTTGGCAGAAAACCGGTC
TTGATTCTCTCATTAATAGGCGCTGTTTGTGATTACACCCTACTCTCATTTTCTAGCGCCTTATGGATGCTCTATCTAGG
GAGAATGATTGCCGGCATTTCTGCTGCAACAGGAGCCGTAGCAGCATCAATGGTCGCAGATCACACAAAAAAAGCAGAGA
GAACTAAATGGTTTGGAAAGTTAGGCGCAGCTTTTGGGGCGGGACTCATTGCCGGACCCGCTATTGGTGGATTTATCGGA
CAATATTCTGCACATTTCCCCTTTATCATTGCCGCAATTTTAAATGCCATTGCTCTTATCATGGTCATTATCCTCTTCCC
TAAAGAGCAATCACGCCCAAAAGAAATCGAGCAAGATCAATCTAAAATTCATGAAAAAACCACCATCAATGCCCCGCTAA
TTCATATTCTCAAACCCGTTTTGCTACTTCTCATGCTGTTTTTTACAGTACAACTCATCGGACAAATCCCTGCATCAACT
TGGGTTCTATTTACTGAGTACCGTTTTGAGTGGAATACCTTTAACATTGGTTTATCCCTTGCAGGGCTAGGGTTAATGCA
TATTATCTTTCAGGCTTTTGTCGCAGGATATATCGCATCTCGCTGGAAAAATGAAACCGTATTTATTCTCGGATTTATAC
TAGATGCGAGCGCATTCTTATTACTGGCCTTTATCTCTCAAGTTTGGCTCGTAATTCCTACATTGATCTTATTAGCAGGA
GGAGGCATCGCCTTACCGGCATTACAAGGATTAATCTCTATAAAGACAGCAGATGAACATCAAGGAAAGATACAAGGTAT
CATGGTTAGCCTCACTAATATTACCGGAATAATTGGACCGCCCATTTTTGCATTTTCCTTTGCAAAAACGGTTACAAACT
GGGATGGCACACTTTGGCTAATCGGTGCTGTACTCTATAGCATTTTATTAGGTCTCTATTTTCTCTATCAAAAGATACGC
GCCTATAAACAACTTAAGTCTCAAACTGCTTAA