MEGAResFrom MEG, the Microbial Ecology Group

TCR3

The tcr3 gene (also known as tcrC) encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>CARD|phgb|D38215|0-1539|ARO:3002893|tcr3|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TCR3
ATGGGAATGGCGAACGCCACCTCGCAGACCGGCGAGGCCGTCGCGGACGAGGCCGGCGGCCCCGCCGGCTTCACTCACCG
CCAGATCATCACCGCGCTGTCCGGGCTCCTGTTGGCCGTGCTGCTCGCCGCACTCGACCAGACGATCGTCTCCACCGCGC
TGCGTACGATCGGCGACCAACTGCACGGCCAGACCGTCCAGGCCTGGGTGATCACCGGCTACCTGGTCAGCTCCACGATC
GCGATGCCGTTCTACGGCAAGCTGTCCGACATCTACGGCCGCAAGCCGCTCTATCTGGCGGCGATCGCGGTCTTCATCGT
CGGCTCGGCGGCCTGCGCGATGGCGAACTCGATGGAGACGCTGGCGATCGCCCGCGTCCTCCAGGGCTTCGGCGGCGCCG
GGCTGATGTCGCTGCCGACGGCCGTCATCGCCGACCTCGCCCCGGTGCGCGAGCGCGGGCGCTACTTCTCGTACCTGATG
ATGGCCTGGGTGGCGGCCAGTGTGCTCGGCCCGCTCGTCGGGGGCCTGTTCGCGGGCGCCGGCGAGATCCTCGGGGTGAC
CGGCTGGCGCTGGGCCTTCCTGATCAACGTGCCGCTCGGTCTCGTGGCGCTGCTCAGCGTGCGCAAGGCGCTCAACCTGC
CGCACCGCAGGGTGGACCACCCGATCGACTTCCGGGGGGCGCTCACCCTGGCGCTCTGCCTGGTGCCGCTGCTGATCGTG
GCGGAGGAGGGCCTCGACTGGGGCTGGGGATCGGCGCGTTCGCTGACGCTGTTCGCCGTCTCGCTGATCGGCCTGGTGCT
GTTCGTGCTCGCCGAGCGGGCCCGCGGGCTGGAGGCGATGGTCCCGCTGCGGCTGTTCCGGCGCGGTGGCATCACGATGG
CCACGGCCGTCAACTTCACCATCGGCGTCGGCATCTTCGGTACGGTCTCCACCCTGCCGCTGTTCCTGCAGCTGGTGCAG
GGGCGCAGTGCCACCGTCGCCGGACTGGTGATCATCCCGGTGATGACCGGGGCGATCGTCTCCCAGACGATCTGCGCCAA
GATCATCAAGAAGTGGAACCGCTACAAGAAGCCCGCGATCGTGGGCCTCGGCTCGATGGCCGGAGCACTGCTGTCGCTCT
CCGCCGCGGGCGCGGACACCCCGCTCGCGGTGATCGTGGTGATCGCGGCCTGGCTGGGCTTCGGCATCGGGCTCTCCCAG
ACCGTCATCACCCTGGCGATCCAGAGCTCGGCGCCCAAGTCCGAGCTGGGCGTGGCCAACGCCGCCTCCGGGCTGTTCCG
CCAGCTCGGCGGCACGAGCGGCGCCGCCGTCTTCATGTCGGTGCTGTTCGGCGTCGCCGCCGGCAGGCTCGACGGGGCCG
ACCCGGACGAGGCCGTGCGCCGTGCGCTCTCCGACCCGGGCTCCACCGGCGGCCTGAGCGCCTCGGCGGTCGACGCCTTC
ACCTCGGGCTTCGACACGATGTTCCTGGTCGGCGGCCTGATCCTTGCGGTGGGCTTCCTGCTCACCTTCCCGCTGCGGGA
ACTGCGCGACGAGGAGTGA