MEGAResFrom MEG, the Microbial Ecology Group

TCMA

The tcmA gene encodes an efflux transporter shown to act on tetracyclines.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>CARD|phgb|M80674|877-2494|ARO:3003554|tcmA|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TCMA
ATGAGCACGGAAACGCACGACGAGCCGTCAGGCGTCGCACACACCCCCGCTTCCGGTCTGCGTGGACGTCCCTGGCCGAC
CCTGCTCGCGGTCGCGGTCGGCGTGATGATGGTGGCTCTGGACAGCACCATCGTCGCCATCGCCAACCCGGCCATCCAGC
AGGACCTCCACGCCTCGCTGGCCGATGTGCAGTGGATCACCAACGGCTACCTGCTGGCGCTCGCGGTCTCCCTGATCACC
GCCGGCAAACTGGGCGACAGGTTCGGGCACCGGCAGACCTTCCTGGTCGGAGTGGCGGGCTTCGCCGTCACCTCCGCGGC
CATCGGCCTGTCCGGCAGCGTCGCGGCGATCGTCGTCTTCCGCGTTCTCCAGGGCCTGTTCGGCGCTCTGATGCAGCCGT
CGGCGCTGGGCCTGCTGCGGGTCACGTTCCCGCCCGGCAAGCTCAACATGGCGATCGGCATCTGGAGCGGCGTGGTCGGC
GCCTCGACCGCAGCCGGACCGATCATCGGCGGGCTCCTGGTGCAGCACGTCGGCTGGGAGGCGGTCTTCTTCATCAATGT
GCCGGTCGGCCTCGCGGCACTCGTCGCCGGCCTCGTCATCCTGACCGACGCGCGCGCCGAACGCGCCCCGAAGTCCTTCG
ACGTCTCCGGCATCGTGCTCCTGTCCGGGGCCATGTTCTGCCTGGTGTGGGGTCTGATCAAGGCTCCGGCCTGGGGCTGG
GGCGACCTGCGGACGCTGGGCTTCCTGGCCGCCGCCGTGCTCGCCTTCGCCGGATTCACACTGCGGGAGAGCAGGGCCAC
CGAGCCGCTGATGCCGCTCGCCATGTTCCGTTCCGTGCCGCTGTCCGCGGGCACCGTGCTCATGGTCCTGATGGCGTTCT
CGTTCATCGGCGGACTCTTCTTCGTCACCTTCTACCTGCAGAACGTCCATGGCATGAGCCCGGTCGAGAGCGGTGTGCAC
CTGCTGCCGCTCACCGGCATGATGATCGTCGGCGCCCCCGTGTCCGGCATCGTGATCAGCCGGTTCGGACCAGGCGGGCC
GCTGGTGGTGGGCATGCTCCTGACGGCGGCGTCCCTGTGGGGGATGTCGACGCTGGAAGCGGACAGCGGTATGGGGATCA
CCTCGCTCTGGTTCGTGCTGCTGGGTCTCGGTCTCGCGCCGGTGATGGTGGGGACGACGGACGTCATCGTCAGCAACGCC
CCGGCCGAACTGGCCGGTGTGGCCGGTGGTCTTCAGCAGTCCGCGATGCAGGTCGGCGGAAGTCTCGGCACCGCCGTACT
CGGTGTCCTCATGGCCTCCCGGGTCGGCGACGTCTTCCCCGACAAGTGGGCGGAGGCGAACCTGCCGCGGGTGGGTCCGC
GGGAGGCCGCGGCGATCGAGGACGCGGCCGAGGTGGGAGCCGTCCCGCCGGCCGGCACCCTCCCCGGCCGGCACGCCGGG
ACGCTCTCCGAGGTGGTCCACTCCTCGTTCATCTCGGGGATGGGGCTGGCCTTCACCGTGGCCGGTGCCGTCGCGCTCGT
GGCCGCCGCCGTCGCCCTGTTCACCAGGAAGGCCGAGCCCGACGAGAGGGCCCCGGAGGAATTCCCGGTCCCGGCGTCCA
CGGCAGGGCGGGGCTGA