MEGAResFrom MEG, the Microbial Ecology Group

OTRB

The otrB gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|ortB_1_AF079900|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|OTRB
GTGTCATCCGCAAATCCGGGCCCGGCGGGCACGGCGGACCAGGCAGGCGGGGCGTTCACGCATCGGCAGATCCTGACGGC
CATGTCGGGACTGCTGCTGGCCGTGTTCCTCGCGGCCCTGGACCAGACGGTCATCGCCACCGCGATGCGCACCATCGCGG
ACGACCTCCACGGCCAGACCGAGCAGGCATGGGCGACGACGGGCTACCTCATCGCCTCCGTCCTGGCGATGCCGTTCTAC
GGCAAGCTGTCCGACATCTACGGGCGCAAGCCCATGTACCTGATCTCCATCGTGGTGTTCATCGGCGGCTCGGTGCTGTG
CGGCACGGCCGGCTCGATGTGGGAGCTGGCCCTCTTCCGGGCCGTCCAGGGACTGGGCGGCGGCGGGCTGATGTCCCTGC
CCACCGCGGTGGTCGCCGACCTCGCCCCGGTGCGCGAGCGCGGCCGCTACTTCGCCTTCCTCCAGATGGCGTGGGTGGTC
GCCAGCGTCGCGGGCCCGCTGGCGGGCGGCTTCTTCGCGGAGGCGGGCCAGGTCTTCGGCATCGACGGCTGGCGCTGGGT
GTTCCTGCTCAACGTACCGCTGGGCCTGCTGGCCCTGGTCACCGTGCGCAAGGCCCTGAACCTGCCGCACGAACGGCGCG
AGCACCGCATGGACGTACTGGGCGCGGCGGCGCTGGCGCTGTTCCTGGTGCCCCTGCTGATCGTCGCCGAACAGGGCCGG
ACCTGGGGCTGGGGCTCGCCGGCCGCCCTCGCCCTCTTCGCGCTCGGCGCGGCCGGGCTGGCGGTCTTCATCCCCGTCGA
GCTGCGGCGCGGCGACGAGGCCATCCTGCCGCTGGGGCTCTTCCGGCGCGGCAGCATCGCGCTGTGCTCCGCGGTCAACT
TCACCATCGGCGTCGGCATCTTCGGCACGGTCACCACCCTGCCGCTGTTCCTCCAGATGGTGCAGGGGCGGACCCCGACC
CAGGCCGGACTGGTGGTCATCCCGTTCATGCTGGGCACCATCGCCTCGCAGATGGTCTCCGGCAAGCTCATCGCGTCCTC
GGGCCGGTTCAAGAAACTGGCGATCGTGGGCCTGGGCTCGATGGCCGGGGCGCTGCTGGCCATGGCCACCACCGGCGCGA
CGACCCCGATGTGGGGCATCGTCCTGATCGTCCTCTGGCTCGGCGTCGGCATCGGCCTGTCCCAGACCGTCATCACCTCG
CCCATGCAGAACTCGGCCCCCAAGAGCCAGCTCGGCGTGGCGAACGGCGCCTCCGGCCTGTGCCGGCAGATCGGCGGCTC
CACCGGCATCGCGGTTCTGTTCTCCGTGATGTTCGCGGTGGCGCTCGGCCGCCTCGCCGACCTGCTGCACACCCCGCGCT
ACGAGCGCCTCCTGACGGACCCGGCGATCACCGGCGACCCCGCCAACCACCGCTTCCTTGACATGGCCGAGTCCGGGCAG
GGCGCGGGGATCAACCTTGACGACACGTCCCTGCTGAACGGCATCGACGCCCGGCTGATGCAGCCGGTGACGGATTCCTT
CGCCCACGGCTTCCACATCATGTTCCTCGCCGGCGGCGTGGTGCTGCTGGCCGGGTTCGTCATGACCTGGTTCCTGCGCG
AACTCCAGGAGGAGACCGCGCCGGAGGAGGAGCGGCCGGCCGAGAGCGGCGCCGGGGCGAAGAACGGGCCGCTGCCCGCG
TCGGACGCCTGA

>Tet|OtrB|AF079900|40-1733|1692|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|OTRB
GTGTCATCCGCAAATCCGGGCCCGGCGGGCACGGCGGACCAGGCAGGCGGGGCGTTCACGCATCGGCAGATCCTGACGGC
CABGTCGGGACTGCTGCTGGCCGTGTTCCTCGCGGCCCTGGACCAGACGGTCATCGCCACCGCGATGCGCACCATCGCGG
ACGACCTCCACGGCCAGACCGAGCAGGCATGGGCGACGACGGGCTACCTCATCGCCTCCGTCCTGGCGATGCCGTTCTAC
GGCAAGCTGTCCGACATCTACGGGCGCAAGCCCATGTACCTGATCTCCATCGTGGTGTTCATCGGCGGCTCGGTGCTGTG
CGGCACGGCCGGCTCGATGTGGGAGCTGGCCCTCTTCCGGGCCGTCCAGGGACTGGGCGGCGGCGGGCTGATGTCCCTGC
CCACCGCGGTGGTCGCCGACCTCGCCCCGGTGCGCGAGCGCGGCCGCTACTTCGCCTTCCTCCAGATGGCGTGGGTGGTC
GCCAGCGTCGCGGGCCCGCTGGCGGGCGGCTTCTTCGCGGAGGCGGGCCAGGTCTTCGGCATCGACGGCTGGCGCTGGGT
GTTCCTGCTCAACGTACCGCTGGGCCTGCTGGCCCTGGTCACCGTGCGCAAGGCCCTGAACCTGCCGCACGAACGGCGCG
AGCACCGCATGGACGTACTGGGCGCGGCGGCGCTGGCGCTGTTCCTGGTGCCCCTGCTGATCGTCGCCGAACAGGGCCGG
ACCTGGGGCTGGGGCTCGCCGGCCGCCCTCGCCCTCTTCGCGCTCGGCGCGGCCGGGCTGGCGGTCTTCATCCCCGTCGA
GCTGCGGCGCGGCGACGAGGCCATCCTGCCGCTGGGGCTCTTCCGGCGCGGCAGCATCGCGCTGTGCTCCGCGGTCAACT
TCACCATCGGCGTCGGCATCTTCGGCACGGTCACCACCCTGCCGCTGTTCCTCCAGATGGTGCAGGGGCGGACCCCGACC
CAGGCCGGACTGGTGGTCATCCCGTTCATGCTGGGCACCATCGCCTCGCAGATGGTCTCCGGCAAGCTCATCGCGTCCTC
GGGCCGGTTCAAGAAACTGGCGATCGTGGGCCTGGGCTCGATGGCCGGGGCGCTGCTGGCCATGGCCACCACCGGCGCGA
CGACCCCGATGTGGGGCATCGTCCTGATCGTCCTCTGGCTCGGCGTCGGCATCGGCCTGTCCCAGACCGTCATCACCTCG
CCCATGCAGAACTCGGCCCCCAAGAGCCAGCTCGGCGTGGCGAACGGCGCCTCCGGCCTGTGCCGGCAGATCGGCGGCTC
CACCGGCATCGCGGTTCTGTTCTCCGTGATGTTCGCGGTGGCGCTCGGCCGCCTCGCCGACCTGCTGCACACCCCGCGCT
ACGAGCGCCTCCTGACGGACCCGGCGATCACCGGCGACCCCGCCAACCACCGCTTCCTTGACATGGCCGAGTCCGGGCAG
GGCGCGGGGATCAACCTTGACGACACGTCCCTGCTGAACGGCATCGACGCCCGGCTGATGCAGCCGGTGACGGATTCCTT
CGCCCACGGCTTCCACATCATGTTCCTCGCCGGCGGCGTGGTGCTGCTGGCCGGGTTCGTCATGACCTGGTTCCTGCGCG
AACTCCAGGAGGAGACCGCGCCGGAGGAGGAGCGGCCGGCCGAGAGCGGCGCCGGGGCGAAGAACGGGCCGCTGCCCGCG
TCGGACGCCTGA

>Tet|ortB_2_AF061335|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|OTRB
ATGTCGGGACTGCTGCTGGCCGTGTTCCTCGCGGCCCTGGACCAGACGGTCATCGCCACCGCGATGCGCACCATCGCGGA
CGACCTCCACGGCCAGACCGAGCAGGCATGGGCGACGACGGGCTACCTCATCGCCTCCGTCCTGGCGATGCCGTTCTACG
GCAAGCTGTCCGACATCTACGGGCGCAAGCCCATGTACCTGATCTCCATCGTGGTGTTCATCGGCGGCTCGGTGCTGTGC
GGCACGGCCGGCTCGATGTGGGAGCTGGCCCTCTTCCGGGCCGTCCAGGGACTGGGCGGCGGCGGGCTGATGTCCCTGCC
CACCGCGGTGGTCGCCGACCTCGCCCCGGTGCGCGAGCGCGGCCGCTACTTCGCCTTCCTCCAGATGGCGTGGGTGGTCG
CCAGCGTCGCGGGCCCGCTGGCGGGCGGCTTCTTCGCGGAGGCGGGCCAGGTCTTCGGCATCGACGGCTGGCGCTGGGTG
TTCCTGCTCAACGTACCGCTGGGCCTGCTGGCCCTGGTCACCGTGCGCAAGGCCCTGAACCTGCCGCACGAACGGCGCGA
GCACCGCATGGACGTACTGGGCGCGGCGGCGCTGGCGCTGTTCCTGGTGCCCCTGCTGATCGTCGCCGAACAGGGCCGGA
CCTGGGGCTGGGGCTCGCCGGCCGCCCTCGCCCTCTTCGCGCTCGGCGCGGCCGGGCTGGCGGTCTTCATCCCCGTCGAG
CTGCGGCGCGGCGACGAGGCCATCCTGCCGCTGGGGCTCTTCCGGCGCGGCAGCATCGCGCTGTGCTCCGCGGTCAACTT
CACCATCGGCGTCGGCATCTTCGGCACGGTCACCACCCTGCCGCTGTTCCTCCAGATGGTGCAGGGGCGGACCCCGACCC
AGGCCGGACTGGTGGTCATCCCGTTCATGCTGGGCACCATCGCCTCGCAGATGGTCTCCGGCAAGCTCATCGCGTCCTCG
GGCCGGTTCAAGAAACTGGCGATCGTGGGCCTGGGCTCGATGGCCGGGGCGCTGCTGGCCATGGCCACCACCGGCGCGAC
GACCCCGATGTGGGGCATCGTCCTGATCGTCCTCTGGCTCGGCGTCGGCATCGGCCTGTCCCAGACCGTCATCACCTCGC
CCATGCAGAACTCGGCCCCCAAGAGCCAGCTCGGCGTGGCGAACGGCGCCTCCGGCCTGTGCCGGCAGATCGGCGGCTCC
ACCGGCATCGCGGTTCTGTTCTCCGTGATGTTCGCGGTGGCGCTCGGCCGCCTCGCCGACCTGCTGCACACCCCGCGCTA
CGAGCGCCTCCTGACGGACCCGGCGATCACCGGCGACCCCGCCAACCACCGCTTCCTTGACATGGCCGAGTCCGGGCAGG
GCGCGGGGATCAACCTTGACGACACGTCCCTGCTGAACGGCATCGACGCCCGGCTGATGCAGCCGGTGACGGATTCCTTC
GCCCACGGCTTCCACATCATGTTCCTCGCCGGCGGCGTGGTGCTGCTGGCCGGGTTCGTCATGACCTGGTTCCTGCGCGA
ACTCCAGGAGGAGACCGCGCCGGAGGAGGAGCGGCCGGCCGAGAGCGGCGCCGGGGCGAAGAACGGGCCGCTGCCCGCGT
CGGACGCCTGA