MEGAResFrom MEG, the Microbial Ecology Group

TETZ

The tetZ gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7247|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETZ
ttgcactttatcatcgataactttatcttagataaagtgactgctcgctactctcatctgactgctcgctactctcatcg
tggaatcctgacagccgtgctcatcacggcgaccctcgatgctgcagggctgggcctcgtgatgccgatcttgcctaccc
ttctcgaccaggtcggtgcccccgacgacatgatcccactgcacgtcggactactgacagcgctctatgcgatcatgcag
tttctttgcgccccgatccttggccgactctctgaccgtttcggacgccgccgcgtgcttgtcgcctccctcgcaggcgc
gacgatcgactacctcgtgctcgcactgacggacacgctgtgggtcttttacctcgcccgcgcggttgcaggcattaccg
gcgccacgaacgccgtcaccgcgacggtgatcgccgacattactccgccggatcagcgcgcaaaacgctacgggtggctc
ggcgcatgctacggcggtggcatgatcgcgggtcccgccattggcggtcttttcggcggggtctcaccgcatctgccatt
cctcgtcgccgccgcgctcgccggaatcaccctcgtactcagcgcgagtcttctgcgtgagacgcggccaccgggcagca
acggctcgcacgcacagcaacccggtacggcgaagcgaaccgcagtgccggggatgcttatccttctcgcagtcttcggc
atcgtgcagttcatcggccaagcaccaggctccacctgggtgctcttcacgcagcagcgcctcgactggaaccccgtcga
agtcggcgtttcgctatccatcttcggaatggtgcaagtattcgtgcaggcggcactgaccggacgcatcgtgtcccgga
tcggcgagacccgggcgatcctcgtcggtatcgccgcagacgccattgggctcatcggccttgccctcatcgccagcaca
tgggcgatgctaccgatcctcgcagcgctcggactcggcagcatcacgttgcccgcactgcagacgctgctctcgagacg
cgcgcccgagcagcagcagggacgcctgcagggaacacttgcaagcctgaacagcctcacctcgatcatcggcccggtca
ccttcaccggcattttcgcactcacccgaacgaatgcagacggcaccctctggatctgcgccgcagcgctctacgttctc
tgcgccctcctgatgatccgtgagacatgcgcctcacggcgatctcgataa

>>MEG_7248|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETZ
GTGCTCATCACGGCGACCCTCGATGCTGCAGGGCTGGGCCTCGTGATGCCGATCTTGCCTACCCTTCTCGACCAGGTCGG
TGCCCCCGACGACATGATCCCACTGCACGTCGGACTACTGACAGCGCTCTATGCGATCATGCAGTTTCTTTGCGCCCCGA
TCCTTGGCCGACTCTCTGACCGTTTCGGACGCCGCCGCGTGCTTGTCGCCTCCCTCGCAGGCGCGACGATCGACTACCTC
GTGCTCGCACTGACGGACACGCTGTGGGTCTTTTACCTCGCCCGCGCGGTTGCAGGCATTACCGGCGCCACGAACGCCGT
CACCGCGACGGTGATCGCCGACATTACTCCGCCGGATCAGCGCGCAAAACGCTACGGGTGGCTCGGCGCATGCTACGGCG
GTGGCATGATCGCGGGTCCCGCCATTGGCGGTCTTTTCGGCGGGGTCTCACCGCATCTGCCATTCCTCGTCGCCGCCGCG
CTCGCCGGAATCACCCTCGTACTCAGCGCGAGTCTTCTGCGTGAGACGCGGCCACCGGGCAGCAACGGCTCGCACGCACA
GCAACCCGGTACGGCGAAGCGAACCGCAGTGCCGGGGATGCTTATCCTTCTCGCAGTCTTCGGCATCGTGCAGTTCATCG
GCCAAGCACCAGGCTCCACCTGGGTGCTCTTCACGCAGCAGCGCCTCGACTGGAACCCCGTCGAAGTCGGCGTTTCGCTA
TCCATCTTCGGAATGGTGCAAGTATTCGTGCAGGCGGCACTGACCGGACGCATCGTGTCCCGGATCGGCGAGACCCGGGC
GATCCTCGTCGGTATCGCCGCAGACGCCATTGGGCTCATCGGCCTTGCCCTCATCGCCAGCACATGGGCGATGCTACCGA
TCCTCGCAGCGCTCGGACTCGGCAGCATCACGTTGCCCGCACTGCAGACGCTGCTCTCGAGACGCGCGCCCGAGCAGCAG
CAGGGACGCCTGCAGGGAACACTTGCAAGCCTGAACAGCCTCACCTCGATCATCGGCCCGGTCACCTTCACCGGCATTTT
CGCACTCACCCGAACGAATGCAGACGGCACCCTCTGGATCTGCGCCGCAGCGCTCTACGTTCTCTGCGCCCTCCTGATGA
TCCGTGAGACATGCGCCTCACGGCGATCTCGATAA