MEGAResFrom MEG, the Microbial Ecology Group

TETL

The tetL gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7092|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
atgaatacgtcttattcacaatcaaatttacgacacaaccaaattttaatttggctttgcgttctatctttttttagcgt
attaaatgaaatggttttgaacgtctcattacctgatattgcaaatgattttaataaatcaccggcgagtacaaactggg
tgaacacagcctttatgttaaccttttctattggaacagctctatatggaaagctatctgatcagctaggcattaaaagg
ttactcctatttgggattataataaattgcttcggatcggtaattgcgtttgttggacattctttttttcccatacttat
tctggctcgatttattcaaggagctggtgcagctgcatttccagcactcgtgatggttgtagttgcgcgctatattccaa
aggaaaataggggtaaagcgtttggtcttattggctccatagtagctatgggagaaggtatcggtccagctattggtgga
atgatagctcattttatccattggtcttatcttctgctcattccaatgatgacaattatcactgttccgttccttattaa
attgttgaaaaaagaagtaaggataaaaggtcattttgatattgtaggaattatactaatgtcagtgggcattgtatttt
ttatgctgtttacaacatcttataacatttcttttctgatcatcagtattctgtcattcctgatatttgtaaaacatatt
aggaaagtaacagaaccttttgttgaacctgcactggggaaaaatatttcttttataattggtgtcctttgtggaggact
tatatttggtacagtagcagggtttatctctatggttccttacatgatgaaagatgtatatcaactaagtactgctgcaa
ttggcagtgtgattattttccctggagcaatgagcgttattatcttcggttacattggtggattacttgttgatagaaaa
ggtccattgtacgtgttaaccattggagttacatttctttccgttagctttttaattgctgccttttttttagaagtaac
accatggttactgacaattatattagtttttgtttttggtgggctgtcattcaccaaaacagttatatctacaattgttt
caagtagtttgaaacaaaaggaagctggtgccggaatgagtttgcttaattttaccagttttttatcagagggaatgggt
attgcaattgttggtggtttattatctgtacgcttactgaatcagaagttgctacctatggaccttgatcaatccactta
tttgtatagtaatatgctattcctttttacaggagtcgttgttactagttggctgatcaccttgaatgtatataaacgaa
gacaaattcaatttaaaagttga

>>MEG_7093|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
gtgaatacatcctattcacaatcgaatttacgacacaaccaaattttaatttggctttgcattttatctttttttagcgt
attaaatgaaatggttttgaacgtctcattacctgatattgcaaatgattttaataaaccacctgcgagtacaaactggg
tgaacacagcctttatgttaaccttttccattggaacagctgtatatggaaagctatctgatcaattaggcatcaaaagg
ttactcctatttggaattataataaattgtttcgggtcggtaattgggtttgttggccattctttcttttccttacttat
tatggctcgttttattcaaggggctggtgcagctgcatttccagcactcgtaatggttgtagttgcgcgctatattccaa
aggaaaataggggtaaagcatttggtcttattggatcgatagtagccatgggagaaggagtcggtccagcgattgttgga
atgatagcccattatattcattggtcctatcttctactcattcctatgataacaattatcactgttccgtttcttatgaa
attattaaagaaagaagtaaggataaaaggtcattttgatatcaaaggaattatactaatgtctgtaggcattgtatttt
ttatgttgtttacaacatcatatagcatttcttttcttatcgttagcgtgctgtcattcctgatatttgtaaaacatatc
aggaaagtaacagatccttttgttgatcccggattagggaaaaatatactttttatgattggagttctttgtgggggaat
tatatttggaacagtagcagggtttgtctctatggttccttatatgatgaaagatgttcaccagctaagtactgccgaaa
tcggaagtgtaattattttccctggaacaatgagtgtcattattttcggctacattggtgggatacttgttgatagaaga
ggtcctttatacgtgttaaacatcggagttacatttctttctgttagctttttaactgctttctttcttttagaaacaac
atcatggttcatgacaattataatcgtatttgttttaggtgggctttcgttcaccaaaacagttataccaacaattgttt
caagtagcttgaaacagcaggaagctggtgctggaatgagtttgcttaactttaccagctttttatcagagggaacaggt
attgcaattgtaggtggtttattatccatacccttacttgatcaaaggttgttacctatgggagttgatcagtcaactta
tctgtatagtaatttgttattacttttttcaggaatcattgtcattagtgggctggttaccgtgaatgtatataaacatt
ctcaacgggatttctaa

>>MEG_7094|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
gtgaatacgtcttattcacaatcaaatttacgacacaaccaaattttaatttggctttgcgttctatctttttttagcgt
attaaatgaaatggttttgaacgtctcattacctgatattgcaaatgattttaataaatcaccggcgagtacaaactggg
tgaacacagcctttatgttaaccttttctattggaacagctctatatggaaagctatctgatcagctaggcattaaaagg
ttactcctatttgggattataataaattgcttcggatcggtaattgggtttgttggacattctttttttcccatacttat
tctggctcgatttattcaaggagctggtgcagctgcatttccagcactcgtgatggttgtagttgcgcgctatattccaa
aggaaaataggggtaaagcgtttggtcttattggctccatagtagctatgggagaaggtatcggtccagctattggtgga
atgatagctcattttatccattggtcttatcttctgctcattccaatgatgacaattatcactgttccgttccttattaa
attgttgaaaaaagaagtaaggataaaaggtcattttgatattgtaggaattatactaatgtcagtgggcattgtatttt
ttatgctgtttacaacatcttataacatttcttttctgatcatcagtattctgtcattcctgatatttgtaaaacatatt
aggaaagtaacagaaccttttgttgaacctgcactggggaaaaatatttcttttataattggtgtcctttgtggaggact
tatatttggtacagtagcagggtttatctctatggttccttacatgatgaaagatgtacatcaactaagtactgctgcaa
ttggcagtgtgattattttccctggagcaatgagcgttattatcttcggttacattggtggattacttgttgatagaaaa
ggtccattgtacgtgttaaccattggagttacatttctttccgttagctttttaattgctgccttttttttagaagtaac
accatggttactgacaattatattagtttttgtttttggtgggctgtcattcaccaaaacagttatatctacaattgttt
caagtagtttgaaacaaaaggaagctggtgccggaatgagtttgcttaattttaccagttttttatcagagggaataggt
attgcaattgttggtggtttattatctgtacgcttactgaatcagaagttgctacctatggaccttgatcaatccactta
tttgtatagtaatatgctattcctttttacaggagtcgttgttactagttggctgatcaccttgaatgtatataaacgaa
gacaaattcaatttaaaagttga

>>MEG_7095|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTGTTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>>MEG_7096|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTCTGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTATTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>>MEG_7097|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGTTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTGTTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>>MEG_7098|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACGTCTTATTCACAATCAAATTTACGACACAACCAAATTTTAATTTGGCTTTGCGTTCTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAATCACCGGCGAGTACAAGCTGGG
TGAACACAGCCTTTATGTTAACCTTTTCTATTGGAACAGCTCTATATGGAAAGCTATCTGATCAGCTAGGCATTAAAAGG
TTACTCCTATTTGGGATTATAATAAATTGCTTCGGATCGGTAATTGGGTTTGTTGGACATTCTTTTTTTCCCATACTTAT
TCTGGCTCGATTTATTCAAGGAGCTGGTGCAGCTGCATTTCCAGCACTCGTGATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCGTTTGGTCTTATTGGCTCCATAGTAGCTATGGGAGAAGGTATCGGTCCAGCTATTGGTGGA
ATGATAGCTCATTTTATCCATTGGTCTTATCTTCTGCTCATTCCAATGATGACAATTATCACTGTTCCGTTCCTTATTAA
ATTGTTGAAAAAAGAAGTAAGGATAAAAGGTCATTTTGATATTGTAGGAATTATACTAATGTCAGTGGGCATTGTATTTT
TTATGCTGTTTACAACATCTTATAACATTTCTTTTCTGATCATCAGTATTCTGTCATTCCTGATATTTGTAAAACATATT
AGGAAAGTAACAGAACCTTTTGTTGAACCTGCACTGGGGAAAAATATTTCTTTTATAATTGGTGTCCTTTGTGGAGGACT
TATATTTGGTACAGTAGCAGGGTTTATCTATATGGTTCCTTACATGATGAAAGATGTACATCAACTAAGTACTGCTGCAA
TTGGCAGTGTGATTATTTTCCCTGGAACAATGAGCGTTATTATCTTCGGTTACATTGGTGGATTACTTGTTGATAGAAAA
GGTCCATTGTACGTGTTAACCATTGGAGTTACATTTCTTTCCGTTAGCTTTTTAATTGCTGCCTTTTTTTTAGAAGTAAC
ACCATGGTTACTGACAATTATATTAGTTTTTGTTTTTGGTGGGCTGTCATTCACCAAAACAGTTATATCTACAATTGTTT
CAAGTAGTTTGAAACAAAAGGAAGCTGGTGCCGGAATGAGTTTGCTTAATTTTACCAGTTTTTTATCAGAGGGAATAGGT
ATTGCAATTGTTGGTGGTTTATTATCTGTACGCTTACTGAATCAGAAGTTGCTACCTATGGACCTTGATCAATCCACTTA
TTTGTATAGTAATATGCTATTCCTTTTTACAGGAGTCGTTGTTACTAGTTGGCTGATCACCTTGAATGTATATAAACGAA
GACAAATTCAATTTAAAAGTTGA

>>MEG_7099|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACGTCTTATTCACAGTCAACTTTACGGCACAATCAAGTTTTGATTTGGCTTTGTGTTCTATCATTTTTCAGCGT
ATTAAATGAAATGGTTCTGAACGTCTCATTACCTGATATTGCCAACGAGTTTAATAAACTGCCAGCAAGTGCAAACTGGG
TGAATACAGCCTTTATGTTAACCTTCTCCATTGGAACAGCTCTATATGGAAAGCTATCAGACCAGCTGGGCATCAAAAAT
CTGCTTCTATTTGGGATTATGGTAAATGGCTTAGGGTCGATCATTGGATTTGTTGGACACTCTTTCTTTCCTATTCTCAT
TCTAGCCCGATTTATTCAAGGAATTGGTGCAGCCGCATTCCCAGCTCTTGTGATGGTTGTCGTTGCGCGCTATATTCCAA
AAGAGAACAGGGGGAAAGCATTTGGCCTGATCGGGTCCCTGGTAGCAATGGGAGAAGGTGTTGGGCCAGCTATTGGCGGA
ATGGTTGCTCATTATATCCATTGGTCGTATTTGCTGCTTATTCCAACTGCAACAATTATCACCGTTCCATTCCTTATAAA
ATTGTTGAAAAAGGAAGAGAGAATAAGAGGACACATTGATATGGCAGGGATTATATTGATGTCTGCAGGTATCGTATTTT
TTATGCTGTTTACAACATCTTATAGATTTTCTTTTCTGATCATCAGTATCCTTGCTTTCTTCATATTTGTGCAACACATT
AGGAAAGCTCAGGACCCTTTTGTTGACCCTGAATTAGGGAAAAACGTCTTTTTTGTGATTGGAACCCTTTGCGGAGGACT
AATATTTGGTACAGTAGCAGGATTTGTCTCTATGGTTCCTTACATGATGAAAGATGTTCACCATTTAAGTACTGCAGCAA
TTGGAAGCGGCATTATTTTCCCCGGAACAATGAGTGTCATCATCTTTGGTTACATTGGGGGATTGCTTGTTGATCGGAAA
GGTTCCTTGTATGTACTAACTATTGGAAGTGCCTTGCTTTCTTCCGGCTTTTTAATCGCTGCCTTTTTTATAGATGCAGC
ACCATGGATCATGACAATTATAGTAATTTTTGTTTTTGGGGGGCTATCTTTCACAAAAACAGTTATATCTACAGTTGTGT
CTAGCAGTTTGAAAGAAAAGGAAGCGGGCGCTGGAATGAGTTTGCTTAATTTCACGAGCTTTTTATCAGAGGGAACGGGT
ATTGCGATTGTAGGCGGTTTATTATCTATCGGCTTCCTAGACCATAGGCTGCTGCCTATTGACGTTGATCACTCTACCTA
TTTGTATAGCAATATGCTCATACTTTTTGCAGGAACCATTGTTATTTGTTGGCTAGTAATCTTGAATGTATATAAACGTT
CGCGGAGGCATCGCTAA

>>MEG_7100|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATCATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGGATCTAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GTGCCTTTATATGCGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATTATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCCTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCCACGGTTGTTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATCTATATAAACATT
CTCAAAGGGATTTCTAA

>>MEG_7101|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGT
ATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGG
TGAACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGG
TTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTAT
TATGGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAA
AGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGA
ATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAA
ATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTT
TTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATC
AGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAAT
TATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAA
TCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGA
GGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAAC
ATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTT
CAAGTAGCTTGAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGT
ATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTATTACCTATGGAAGTTGATCAGTCAACTTA
TCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATT
CTCAAAGGGATTTCTAA

>>MEG_7102|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETL
GTGAATACGTCTTATTCACAGTCAACTTTACGGCACAATCAAGTTTTGATTTGGCTTTGTGTTCTATCATTTTTCAGCGT
ATTAAATGAAATGGTTCTGAACGTCTCATTACCTGATATTGCCAACGAGTTTAATAAACTGCCAGCAAGTGCAAACTGGG
TGAATACAGCCTTTATGTTAACCTTCTCCATTGGAACAGCTCTATATGGAAAGCTATCAGACCAGCTGGGCATCAAAAAT
CTGCTTCTATTTGGGATTATGGTAAATGGCTTAGGGTCGATCATTGGATTTGTTGGACACTCTTTCTTTCCTATTCTCAT
TCTAGCCCGATTTATTCAAGGAATTGGTGCAGCCGCATTCCCAGCTCTTGTGATGGTTGTCGTTGCGCGCTATATTCCAA
AAGAGAACAGGGGGAAAGCATTTGGCCTGATCGGGTCCCTGGTAGCAATGGGAGAAGGTGTTGGGCCAGCTATTGGCGGA
ATGGTTGCTCATTATATCCATTGGTCGTATTTGCTGCTTATTCCAACTGCAACAATTATCACCGTTCCATTCCTTATAAA
ATTGTTGAAAAAGGAAGAGAGAATAAGAGGACACATTGATATGGCAGGGATTATATTGATGTCTGCAGGTATCGTATTTT
TTATGCTGTTTACAACATCTTATAGATTTTCTTTTCTGATCATCAGTATCCTTGCTTTCTTCATATTTGTGCAACACATT
AGGAAAGCTCAGGACCCTTTTGTTGACCCTGAATTAGGGAAAAACGTCTTTTTTGTGATTGGAACCCTTTGCGGAGGACT
AATATTTGGTACAGTAGCAGGATTTGTCTCTATGGTTCCTTACATGATGAAAGATGTTCACCATTTAAGTACTGCAGCAA
TTGGAAGCGGCATTATTTTCCCCGGAACAATGAGTGTCATCATCTTTGGTTACATTGGGGGATTGCTTGTTGATCGGAAA
GGTTCCTTGTATGTACTAACTATTGGAAGTGCATTGCTTTCTTCCGGCTTTTTAATCGCTGCCTTTTTTATAGATGCAGC
ACCATGGATCATGACAATTATAGTAATTTTTGTTTTTGGGGGGCTATCTTTCACAAAAACAGTTATATCTACAGTTGTGT
CTAGCAGTTTGAAAGAAAAGGAAGCGGGCGCTGGAATGAGTTTGCTTAATTTCACGAGCTTTTTATCAGAGGGAACGGGT
ATTGCGATTGTAGGCGGTTTATTATCTATCGGCTTCCTAGATCATAGGCTGCTGCCTATTGACGTTGATCACTCTACCTA
TTTGTATAGCAATATGCTCATACTTTTTGCAGGAATCATTGTTATTTGTTGGCTAGTAATCTTGAATGTATATAAACGTT
CGCGGAGACATGGCTAA