MEGAResFrom MEG, the Microbial Ecology Group

TETK

The tetK gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7089|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETK
ttgtttagtttatataaaaaatttaaaggtttgttttatagcgttttattttggctttgtattctttcattttttagtgt
attaaatgaaatggttttaaatgtttctttacctgatattgcaaatcattttaatactactcctggaattacaaactggg
taaacactgcatatatgttaactttttcgataggaacagcagtatatggaaaattatctgattatataaatataaaaaaa
ttgttaattattggtattagtttgagctgtcttggttcattgattgcttttattggtcacaatcacttttttattttgat
ttttggtaggttagtacaaggagtaggatctgctgcattcccttcactgattatggtggttgtagctagaaatattacaa
gaaaaaaacaaggcaaagcctttggttttataggatcaattgtagctttaggtgaagggttaggtccttcaataggggga
ataatagcacattatattcattggtcttacctacttatacttcctatgattacaatagtaactataccttttcttattaa
agtaatggtacctggtaaatcaacaaaaaatacattagatatcgtaggtattgttttaatgtctataagtattatatgtt
ttatgttatttacgacaaattataattggacttttttaatactcttcacaatcttttttgtgatttttattaaacatatt
tcaagagtttctaacccttttattaatcctaaactagggaaaaacattccgtttatgcttggtttgttttctggtgggct
aatattttctatagtagctggttttatatcaatggtgccttatatgatgaaaactatttatcatgtaaatgtagcgacaa
taggtaatagtgttatttttcctggaaccatgagtgttattgtttttggttattttggtggttttttagtggatagaaaa
ggatcattatttgtttttattttaggatcattgtctatctctataagttttttaactattgcattttttgttgagtttag
tatgtggttgactacttttatgtttatatttgttatgggcggattatcttttactaaaacagttatatcaaaaatagtat
caagtagtctttctgaagaagaagttgcttctggaatgagtttgctaaatttcacaagttttttatcagagggaacaggt
atagcaattgtaggaggtttattgtcactacaattgattaatcgtaaactagttctggaatttataaattattcttctgg
agtgtatagtaatattcttgtagccatggctatccttattattttatgttgtcttttgacgattattgtatttaaacgtt
ctaaaaagcagtttgaatag

>>MEG_7090|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETK
TTGTTTAGTTTATATAAAAAATTTAAAGGTTTGTTTTATAGCGTTTTATTTTGGCTTTGTATTCTTTCATTTTTTAGTGT
ATTAAATGAAATGGTTTTAAATGTTTCTTTACCTGATATTGCAAATCATTTTAATACTACTCCTGGAATTACAAACTGGG
TAAACACTGCATATATGTTAACTTTTTCGATAGGAACAGCAGTATATGGAAAATTATCTGATTATATAAATATAAAAAAA
TTGTTAATTATTGGTATTAGTTTGAGCTGTCTTGGTTCATTGATTGCTTTTATTGGTCACAATCACTTTTTTATTTTGAT
TTTTGGTAGGTTAGTACAAGGAGTAGGATCTGCTGCATTCCCTTCACTGATTATGGTGGTTGTAGCTAGAAATATTACAA
GAAAAAAACAAGGCAAAGCCTTTGGTTTTATAGGATCAATTGTAGCTTTAGGTGAAGGGTTAGGTCCTTCAATAGGGGGA
ATAATAGCACATTATATTCATTGGTCTTACCTACTTATACTTCCTATGATTACAATAGTAACTATACCTTTTCTTATTAA
AGTAATGGTACCTGGTAAATCAACAAAAAATACATTAGATATCGTAGGTATTGTTTTAATGTCTATAAGTATTATATGTT
TTATGTTATTTACGACAAATTATAATTGGACTTTTTTAATACTCTTCACAATCTTTTTTGTGATTTTTATTAAACATATT
TCAAGAGTTTCTAACCCTTTTATTAATCCTAAACTAGGGAAAAACATTCCGTTTATGCTTGGTTTGTTTTCTGGTGGGCT
AATATTTTCTATAGTAGCTGGTTTTATATCAATGGTGCCTTATATGATGAAAACTATTTATCATGTAAATGTAGCGACAA
TAGGTAATAGTGTTATTTTTCCTGGAACCATGAGTGTTATTGTTTTTGGTTATTTTGGTGGTTTTTTAGTGGATAGAAAA
GGATCATTATTTGTTTTTATTTTAGGATCATTGTCTATCTCTATAAGTTTTTTAACTATTGCATTTTTTGTTGAGTTTAG
TATGTGGTTGACTACTTTTATGTTTATATTTGTTATGGGCGGATTATCTTTTACTAAAACAGTTATATCAAAAATAGTAT
CAAGTAGTCTTTCTGAAGAAGAAGTTGCTTCTGGAATGAGTTTGCTAAATTTCACAAGTTTTTTATCAGAGGGAACAGGT
ATAGCAATTGTAGGAGGTTTATTGTCACTACAATTGATTAATCGTAAACTAGTTCTGGAATTTATAAATTATTCTTCTGG
AGTGTATAGTAATATTCTTGTAGCCATGGCTATCCTTATTATTTTATGTTGTCTTTTGACGATTATTGTATTTAAACGTT
CTGAAAAGCAGTTTGAATAG

>>MEG_7091|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETK
TTGTTTAGTTTATATAAAAAATTTAAAGGTTTGTTTTATAGCGTTTTATTTTGGCTTTGTATTCTTTCATTTTTTAGTGT
ATTAAATGAAATGGTTTTAAATGTTTCTTTACCTGATATTGCAAATCATTTTAATACTACTCCTGGAATTACAAACTGGG
TAAACACTGCATATATGTTAACTTTTTCGATAGGAACAGCAGTATATGGAAAATTATCTGATTATATAAATATAAAAAAA
TTGTTAATTATTGGTATTAGTTTGAGCTGTCTTGGTTCATTGATTGCTTTTATTGGTCACAATCACTTTTTTATTTTGAT
TTTTGGTAGGTTAGTACAAGGAGTAGGATCTGCTGCATTCCCTTCACTGATTATGGTGGTTGTAGCTAGAAATATTACAA
GAAAAAAACAAGGCAAAGCCTTTGGTTTTATAGGATCAATTGTAGCTTTAGGTGAAGGGTTAGGTCCTTCAATAGGGGGA
ATAATAGCACATTATATTCATTGGTCTTACCTACTTATACTTCCTATGATTACAATAGTAACTATACCTTTTCTTATTAA
AGTAATGGTACCTGGTAAATCAACAAAAAATACATTAGATATCGTAGGTATTGTTTTAATGTCTATAAGTATTATATGTT
TTATGTTATTTACGACAAATTATAATTGGACTTTTTTAATACTCTTCACAATCTTTTTTGTGATTTTTATTAAACATATT
TCAAGAGTTTCTAACCCTTTTATTAATCCTAAACTAGGGAAAAACATTCCGTTTATGCTTGGTTTGTTTTCTGGTTGGGC
TAATATTTTCTATAGTAGCTGGTTTTATATCAATGGTGCCTTATATGATGAAAACTATTTATCATGTAAATGTAGCGACA
ATAGGTAA