MEGAResFrom MEG, the Microbial Ecology Group

TETH

The tetH gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7082|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>>MEG_7083|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGGGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>>MEG_7084|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTTAA

>>MEG_7085|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGTTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>>MEG_7086|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAAGCGATTAA