MEGAResFrom MEG, the Microbial Ecology Group

TETG

The tetG gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7076|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETG
gtgcgcagctctgccatcattgccctgctgatcgtggggctcgacgccatgggtctcggcctcatcatgcccgtccttcc
gacgcttctgcgtgagcttgtgccagcagagcaggtcgccggtcactatggtgccttgctgtcgctctatgcattgatgc
aggtcgtcttcgcacccgtgcttggacagctttcggattcttacggtcggcgtccggtgcttctggcttcccttgcggga
gccgcagtcgattatgcgattatggcatcagcgccggtcttatgggtgctctatatcggccgactcgtctccggcatcac
gggcgcaaccggagctgtagctgcctcaaccattgccgattcgacgggggaaggttctcgcgcacgctggttcggctaca
tgggggcctgttatggggcgggcatgattgccgggccagcacttggtggcatgctcggtggtatctctgctcatgcccca
tttatcgccgccgcccttctcaacgggttcgcgttcctgcttgcctgcattttcctcagggagacccgtcgcggtcatgg
caagaccggaaagccggttcgtatccaaccatttgttctattccggctggacgatgtgttgcgtgggttgactgctcttt
tcgccgttttcttcattattcaactgatcggccaagtgcctgcggccctatgggttatatatggcgaggatcgttttcag
tggaacaccgcgaccgttggtttgtcgctcgcggcgtttggggcaacacatgcgatcttccaagcgtttgttaccggccc
gctttcaagccggcttggagagcggcgcacgctactgtttggcatggctgcggatgcgactggcttcgttcttctggctt
ttgccacgcagggatggatggtgttcccgattctgttgctgcttgccgccgggggtgttggcatgccggccttgcaagca
atgctctcaaacaatgtcagcagtaacaagcaaggggctttgcagggaacgctaacgagcctcaccaatctaagctctat
cgcaggaccgcttggcttcacagcactctattctgccaccgccggagcatggaacggttgggtttggattgtcggcgcga
tcctctatttaatatgtctgccaatactacgcagaccattcgcaacttcattgtga

>>MEG_7077|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTGGGTCTTGACGCCATGGGTCTCGGCCTCATCATGCCCGTCCTTCC
GACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTATGGTGCCTTGCTGTCGCTCTATGCATTGATGC
AGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTCGGCGTCCGGTACTTCTGGCTTCTCTTGCAGGA
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTCTATATCGGCCGACTCGTGTCCGGCGTCAC
GGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACA
TGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATCTCTGCTCATGCCCCG
TTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGCATTTTCCTCAAGGAGACTCATCACAGCCATGG
CGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCTGGATGATGCATTGCGCGGGCTAGGTGCGCTTT
TCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
GCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGCTGCGGATGCGACTGGCTTCGTTCTTCTGGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCGCCGGGGGTGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGAACGCTAACGAGCCTCACCAATCTAAGCTCTAT
CGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTTCATTGTGA

>>MEG_7078|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTCGGTCTCGACGCCATAGGACTCGGCCTCATAATGCCGGTCCTTCC
GACGCTTCTGCGCGAGCTTGTGCCGGCAGAGCAGGTCGCTGGTCACTATGGTGCTTTGCTGTCGCTCTATGCGTTGATGC
AGGTCGTCTGCGCCCCTCTACTTGGGCAATTTTCAGATGGTTACGGTCGGCGTCCGGTGCTTCTGGCTTCTCTTGCGGGG
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTGTATATTGGCCGGCTCATTTCTGGCATCAC
GGGAGCAACCGGAGCTGTAGCTGCCTCAACCATTGCCGATTCGACAGGGGAAGGGTCTCGCGCACGCTGGTTCGGCTACA
TGGGAGCCTGTTATGGGACAGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATTTCTGCTCATGCTCCG
TTTATCGCCGCTGCCCTTCTAAACGGCTTCGCGTTCCTGCTTGCCTGCATTTTTCTCAAGGAGACTAATCGCAGCCATGG
CGAGACCGGAAAACTGGTCCGCATCGAACCATTCGTTCTGTTCCGGCTGGATGATGCATTGCGTGGACTAACCGCGCTTT
TCGCAGTTTTCTTCACTATTCAACTGATCGGCCAAGTGCCTGCGGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGGACACCACGACCGTTGGTTTGTCGCTCGCGGCGTTTGGAGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
TCTTTCAAGCCGGCTTGGAGAGCGGCGCACATTACTGTTTGGCATGGCTGCGGATGCGACTGGCTTCATTCTTCTAGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGCTGCTGCTTGCCGCCGGGGGCGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGAGCTCTACAGGGAACGCTTACAAGCCTCACCAATCTAAGCTCTAT
CGCGGGACCGCTTGGCTTCACGGCACTCTATTCTGCCACCATAGGAGCATGGACCGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCTTTCGCAACTTCATTGTGA

>>MEG_7079|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETG
GCTGCTGATCGTGGGTCTCGACGCCATGGGACTCGGCCTCATCATGCCGGTCCTTCCGGCGCTTCTGCGCGAGCTTGTGC
CGGCGGAGCAGGTCGCTGGTCACTATGGTGCTTTGCTGTCACTCTATGCGTTGATGCAGGTCATCTTCGCGCCCGTGCTT
GGACAGTTTTCAGATGCTTACGGTCGGCGTCCGGTGCTTCTGGCTTCTCTTGCGGGGGCCGCAGTCGATTACACGATTAT
GGCATCAGCGCCGGTCTTATGGGTTCTCTATATCGGCCGAATCGTTTCCGGCGTCACGGGAGCAACCGGAGCCGTAGCAG
CCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACATGGGGGCCTGTTATGGAGCAGGC
ATGATTGCCGGGCCAGCACTTTGTGGCATGCTCGGTGGTATTTCTGCCCATGCTCCGTTTATCGCTGCTGCCCTTCTCAA
CGGCTTCGCGTTCCTGCTTGCCTACATTTTTCTCAAGGAGACTCATCACAGCCATGGCGGGACCCGAAAGCCGGTTCGCA
TCAAACCATTCGTTCTGTTCCGGCTGGATGATACATTGCGCGGGCTAGGTGCGCTTTTCGCAGTTTTCTTCATTATTCAA
CTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATCTATGGCGAGGACCGTTTTCAGTGGGACACCACGACTGTTGGTTT
GTCGCTCGCGGCATTTGGAGCAACACACGCGATCTTCCAAGCGTTTGTTACCGGTCCGCTTTCAAGCCGGCTTGGAGAGC
GGCGCACGCTACTCTTTGGCATGGCTGCGGATGCGACTGGCTTCATTCTTCTGGCTTTTGCCACGCAGGGATGGATGGTG
TTCCCGATTTTGTTGCTGCTTGCCGCCGGAGGTGTTGGCATGCCGGCCTTGCAGGCAATGCTTTCAAATAATGTCAGCGG
TAACAAGCAAGGAGCTTTACAGGGAACGCTTACAAGCCTCACCAATTTAAGTTCTATCGCAGGACCGCTTGGCTTCACGG
CACTCTATTCTGCCACCGCCGGAGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGATCCTCTATTTAATATGTCTGCCA
ATACTACGCAGACCATTCGCA

>>MEG_7080|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTGGGTCTTGACGCCATGGGTCTCGGCCTCATCATGCCCGTCCTTCC
GACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTATGGTGCCTTGCTGTCGCTCTATGCATTGATGC
AGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTCGGCGTCCGGTACTTCTGGCTTCTCTTGCAGGA
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTCTATATCGGCCGACTCGTGTCCGGCGTCAC
GGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACA
TGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATCTCTGCTCATGCCCCG
TTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGCATTTTCCTCAAGGAGACTCATCACAGCCATGG
CGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCTGGATGATGCATTGCGCGGGCTAGGTGCGCTTT
TCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
GCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGCTGCGGATGGCACTGGCTTCGTTCTTCTGGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCGCCGGGGGTGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGAACGCTAACGAGCCTCACCAATCTAAGCTCTAT
CGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTTCATTGGTGATTTAG

>>MEG_7081|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETG
ATGGGTCTCGGCCTCATCATGCCCGTCCTTCCGACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTA
TGGTGCCTTGCTGTCGCTCTATGCATTGATGCAGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTC
GGCGTCCGGTACTTCTGGCTTCTCTTGCAGGAGCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTG
CTCTATATCGGCCGACTCGTGTCCGGCGTCACGGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGG
GGAAGGTTCTCGCGCACGCTGGTTCGGCTACATGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTG
GCATGCTCGGTGGTATCTCTGCTCATGCCCCGTTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGC
ATTTTCCTCAAGGAGACTCATCACAGCCATGGCGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCT
GGATGATGCATTGCGCGGGCTAGGTGCGCTTTTCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCC
TATGGGTCATATATGGCGAGGACCGTTTTCAGTGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACA
CATGCGATCTTCCAAGCGTTTGTTACCGGCCCGCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGC
TGCGGATGCGACTGGCTTCGTTCTTCTGGCTTTTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCG
CCGGGGGTGTTGGCATGCCGGCCTTGCAGGCAATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGA
ACGCTAACGAGCCTCACCAATCTAAGCTCTATCGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGC
ATGGAACGGTTGGGTTTGGATTGTCGGCGCGATCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTT
CATTGTGA