MEGAResFrom MEG, the Microbial Ecology Group

TETB

The tetB gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7037|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccacttaggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagcgcatttgcctttttagcgt
tcatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaacaatgcaaccggtat
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7038|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccacttaggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaacaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7039|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
agggtatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcgctttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattatttgtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcactcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7040|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcgaatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagatttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatgagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7041|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaacaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7042|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7043|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttactcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagtggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagtttttcctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7044|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttattcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccacaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7045|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttattcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggtcattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaacaggagacaagt
gcttag

>>MEG_7046|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
atgaatagttcgacaaagatcgcattggtaattacgttattcgatgccatggggattggccttatcatgccagtcttgcc
aacgttattacgtgaatttattgcttcggaagatatcgctaaccactttggcgtattgcttgcactttatgcgttaatgc
aggttatctttgctccttggcttggaaaaatgtctgaccgatttggtcggcgcccagtgctgttgttgtcattaataggc
gcatcgctggattacttattgctggctttttcaagtgcgctttggatgctgtatttaggccgtttgctttcagggatcac
aggagctactggggctgtcgcggcatcggttattgccgataccacctcagcttctcaacgcgtgaagtggttcggttggt
taggggcaagttttgggcttggtttaatagcggggcctattattggtggttttgcaggagagatttcaccgcatagtccc
ttttttatcgctgcgttgctaaatattgtcactttccttgtggttatgttttggttccgtgaaaccaaaaatacacgtga
taatacagataccgaagtaggggttgagacgcaatcgaattcggtatacatcactttatttaaaacgatgcccattttgt
tgattatttatttttcagcgcaattgataggccaaattcccgcaacggtgtgggtgctatttaccgaaaatcgttttgga
tggaatagcatgatggttggcttttcattagcgggtcttggtcttttacactcagtattccaagcctttgtggcaggaag
aatagccactaaatggggcgaaaaaacggcagtactgctcggatttattgcagatagtagtgcatttgcctttttagcgt
ttatatctgaaggttggttagttttccctgttttaattttattggctggtggtgggatcgctttacctgcattacaggga
gtgatgtctatccaaacaaagagtcatcagcaaggtgctttacagggattattggtgagccttaccaatgcaaccggtgt
tattggcccattactgtttgctgttatttataatcattcactaccaatttgggatggctggatttggattattggtttag
cgttttactgtattattatcctgctatcgatgaccttcatgttaacccctcaagctcaggggagtaaaaccgacaagatc
caagaatga

>>MEG_7047|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAACTTATTGCTTCGGAAGATATCGCTAACCACTTAGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTAACAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>>MEG_7048|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGCAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTAACAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>>MEG_7049|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
ATGAGCAGCTCCATGATTCAGCCTGGGACGGAACGTCAGCTTAAGAACCGCACGAGTTTGGGTCAGACGGTCCGAAATTC
GTTGACGATGGCTTACCGCGGGCTGCTGAAGCTCCGGCGCACGCCCGAGCAGTTGTTTGACGTCACGTTTCAGCCCATTA
TTTTTACGCTGATGTTCACCTATATTTTTGGGGGCGCCATCTCGGGTGACGTGGCGAGTTATTTGCCCGTCATCATTCCC
GGCATCCTCGTCCAGACCGTGATTACGACCTCCGTCGTCACAGGCGTTCAGCTGCGCGAGGATATGGATAAAGGCGTATT
CGACCGATTCAAATCGCTGCCGATTGCACGCATCGCACCGCTGGCGGGTGCCCTGCTGGCAGACACGATTCGGTATACCA
TTGCGACAGTGCTTACCTTTACGATGGGATATATTATGGGGTATCGGCCCGAGGGCGGCTTGGGTTATGTTGCTCTTGCG
GGGTTGGTCGTCATTTTGTGCTCATGGGCCATTAGCTGGATTTTTGCTTTCTGCGGCGTGATTGCAAGATCTGCCTCCGG
CGTGCAGGGGATATCGATGATCGTGCTGTTTCCGCTCACGTTTCTCTCCAACGCGTTCGTGCCGGTGGATACGATGCCGG
GCTGGCTGCAGTGGTTCGTCAATATGAATCCGATCTCGCATCTTGTGACAGCCGTTCGGGATCTCACCAACGCTGGCACC
GTGGGCTGGGATCTCACGATATCCTTGGTTGGCGCCGCGGTTATCGTGGCGATCTTTGCTCCCATTACGGTTCGTGCGTA
CATGCGCCGCACTTGA

>>MEG_7050|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTACAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGATGGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAGCTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGCTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCGGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAATTTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCG
CATTTTTTACAAGATACTACACTTCCTAAACTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGCATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAGAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATAAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAATTC
TAGAGCTACTGTGCTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCGATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGTATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA

>>MEG_7051|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGAATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGATTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATGAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTACTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>>MEG_7052|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCGCTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG