MEGAResFrom MEG, the Microbial Ecology Group

TETA

The tetA gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_7014|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
atggttaataaactttcagcatataaaacttatttattattttcagctattacagcaatgtgtttttcactagtagctac
agttatgatagtgtatcacattgaaacggtgcatttaaatccacttcagcttatacttgttggaactactttagaagtag
catgctttatatttgaaattcctacaggaatagttgcagatgtgtacagtcgtaaactatctattgttattggtgtagtt
ttaacaggagtgggatttattttagaaggttctatttctagtttcgttttcgtacttgtagcacagattgtatggggatt
aggttctacttttattagtggatctgttgaagcttggattgcggaagaagagaaagataaagatttggataaaatttata
taaagggagcacaagcaggacagataggatcggttattggaatagtactaagcactgtaatagctaatttatctgtaaga
ctacctattatagttagtggagtcttatttataattcttgcattatttttatggttatatatgccagaaaataattttaa
atcatctgctccagaggatttaaatacttttaaaaagatgggatatacctttaaatctggtcttaaatttataaaaaata
aacctataattataattttgctttcagtaactttattttatggattatccagtgaaggttatgatagactttctaatatg
cattttttacaagatactatgcttcctaaacttggaaaccttaaaccagtgacttggttcggaatttttggaattgcagg
aatgatattgagtgctatagtaatgcattttatggaaaagaagcttaaggatgatgataagaataaaaatggaaagctgt
tattatgtataaatatattttatatatcatttatgttcatatttgctattacaaaaagatttaacttaatgctaatagct
tatttagcgacaagtacctttagaactataaatgaacctatatttagtgcatggcttaatggacatatagatgacaaggc
cagatctactgtactttctataaatggacaaataaattccttaggtcaaattttaggtggaccaattataggaatcatag
ctacaaatatttcagtgagtatgggtatagcatgtacttcgttattagtaacaccggtattagtgttatatattgttgct
atgataatggataaaaaggtggttgatagagttggaggtattgattatgaagaaaataattaa

>>MEG_7015|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaattctgagcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgt
tgatgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccggtcttgctcgtctcgctg
gccggcgctgctgtcgactacgccatcatggcgacggcgcctttcctttgggttctctatatcgggcggatcgtggccgg
catcaccggggcgactggggcggtagccggcgcttatattgccgatatcactgatggcgatgagcgcgcgcggcacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgggcggtttctccccccac
gctccgttcttcgccgcggcagccttgaacggcctcaatttcctgacgggctgtttccttttgccggagtcgcacaaagg
cgaacgccggccgttacgccgggaggctctcaacccgctcgcttcgttccggtgggcccggggcatgaccgtcgtcgccg
ccctgatggcggtcttcttcatcatgcaacttgtcggacaggtgccggccgcgctttgggtcattttcggcgaggatcgc
tttcactgggacgcgaccacgatcggcatttcgcttgccgcatttggcattctgcattcactcgcccaggcaatgatcac
cggccctgtagccgcccggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcacaggctacatcctgc
ttgccttcgcgacacggggatggatggcgttcccgatcatggtcctgcttgctacgggtggcatcggaatgccggcgctg
caagcaatgttgtccaggcaggtggatgaggaacgtcaggggcagctgcaaggctcactggcggcgctcaccagcctgac
ctcgatcgtcggacccctcctcttcacggcgatctatgcggcttctataacaacgtggaacgggtgggcatggattgcag
gcgctgccctctacttgctctgcctgccggcgctgcgtcgcgggctttggagcggcgcagggcaacgagccgatcgctga

>>MEG_7016|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaattctgagcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgt
tgatgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccggtcttgctcgtctcgctg
gccggcgctgctgtcgactacgccatcatggcgacggcgcctttcctttgggttctctatatcgggcggatcgtggccgg
catcaccggggcgactggggcggtagccggcgcttatattgccgatatcactgatggcgatgagcgcgcgcggcacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgggcggtttctccccccac
gctccgttcttcgccgcggcagccttgaacggcctcaatttcctgacgggctgtttccttttgccggagtcgcacaaagg
cgaacgccggccgttacgccgggaggctctcaacccgctcgcttcgttccggtgggcccggggcatgaccgtcgtcgccg
ccctgatggcggtcttcttcatcatgcaacttgtcggacaggtgccggccgcgctttgggtcattttcggcgaggatcgc
tttcactgggacgcgaccacgatcggcatttcgcttgccgcatttggcattctgcattcactcgcccaggcaatgatcac
cggccctgtagccgcccggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcacaggctacatcctgc
ttgccttcgcgacacggggatggatggcgttcccgatcatggtcctgcttgcttcgggtggcatcggaatgccggcgctg
caagcaatgttgtccaggcaggtggatgaggaacgtcaggggcagctgcaaggctcactggcggcgctcaccagcctgac
ctcgatcgtcggacccctcctcttcacggcgatctatgcggcttctataacaacgtggaacgggtgggcatggattgcag
gcgctgccctctacttgctctgcctgccggcgctgcgtcgcgggctttggagaaattcttcaaattcccgttgcacatag

>>MEG_7017|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaattctgagcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgt
tgatgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccggtcttgctcgtctcgctg
gccggcgctgctgtcgactacgccatcatggcgacggcgcctttcctttgggttctctatatcgggcggatcgtggccgg
catcaccggggcgactggggcggtagccggcgcttatattgccgatatcactgatggcgatgagcgcgcgcggcacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgggcggtttctccccccac
ggtccgttcttcgccgcggcagccttgaacggcctcaatttcctgacgggctgtttccttttgccggagtcgcacaaagg
cgaacgccgtccgttacgcgggagctctcacccgctcgcttcgttccggtgggcccggggcatgaccgtcgtcgccgccc
tgatggcggtcttcttcatcatgcaacttgtcggacaggtgccggccgcgctttgggtcattttcggcgaggatcgcttt
cactgggacgcgaccacgatcggcatttcgcttgccgcatttggcattctgcattcactcgcccaggcaatgatcaccgg
ccctgtagccgcccggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcacaggctacatcctgcttg
ccttcgcgacacggggatggatggcgttcccgatcatggtcctgcttgcttcgggtggcatcggaatgccggcgctgcaa
gcaattttgtccaggcaggtggatgaggaacgtcaggggcagctgcaaggctcactggcggcgctcaccagcctgacctc
gatcgtcggacccctcctcttcacggcgatctatgcggcttctataacaacgtggaacgggtgggcatggattgcaggcg
ctgccctctacttgctctgcctgccggcgctgcgtcgcgggctttggagaaattcttcaaattcccgttgcacatag

>>MEG_7018|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaattctgagcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgt
tggtgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgctg
gccggcgccactgtcgactacgccatcatggcgacagcgcctttcctttgggttctctatatcgggcggatcgtggccgg
catcaccggggcgactggggcggtagccggcgcttatattgccgatatcactgatggcgatgagcgcgcgcggcacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgggcggtttctccccccac
gctccgttcttcgccgcggcagccttgaacggcctcaatttcctgacgggctgtttccttttgccggagtcgcacaaagg
cgaacgccggccgttacgccgggaggctctcaacccgctcgcttcgttccggtgggcccggggcatgaccgtcgtcgccg
ccctgatggcggtcttcttcatcatgcaacttgtcggacaggtgccggccgcgctttgggtcattttcggcgaggatcgc
tttcactgggacgcgaccacgatcggcatttcgcttgccgcatttggcattctgcattcactcgcccaggcaatgatcac
cggccctgtagccgcccggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcacaggctacatcctgc
ttgccttcgcgacacggggatggatggcgttcccgatcatggtcctgcttgcttcgggtggcatcggaatgccggcgctg
caaacaatgttgtccaggcaggtggatgaggaacgtcaggggcagctgcaaggctcactggcggcgctcaccagcctgac
ctcgatcgtcggacccctcctcttcacggcgatctatgcggcttctataacaacgtggaacgggtgggcatggattgcag
gcgctgccctctacttgctctgcctgccggcgctgcgtcgcgggctttggagcggcgcagggcaacgagccgatcgctga

>>MEG_7019|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaattctgagcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgt
tggtgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgctg
gccggcgccactgtcgactacgccatcatggcgacagcgcctttcctttgggttctctatatcgggcggatcgtggccgg
catcaccggggcgactggggcggtagccggcgcttatattgccgatatcactgatggcgatgagcgcgcgcggcacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgggcggtttctccccccac
gctccgttcttcgccgcggcagccttgaacggcctcaatttcctgacgggctgtttccttttgccggagtcgcacaaagg
cgaacgccggccgttacgccgggaggctctcaacccgctcgcttcgttccggtgggcccggggcatgaccgtcgtcgccg
ccctgatggcggtcttcttcatcatgcaacttgtcggacaggtgccggccgcgctttgggtcattttcggcgaggatcgc
tttcactgggacgcgaccacgatcggcatttcgcttgccgcatttggcattctgcattcactcgcccaggcaatgatcac
cggccctgtagccgcccggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcacaggctacatcctgc
ttgccttcgcgacacggggatggatggcgttcccgatcatggtcctgcttgcttcgggtggcatcggaatgccggcgctg
caagcaatgttgtccaggcaggtggatgaggaacgtcaggggcagctgcaaggctcactggcggcgctcaccagcctgac
ctcgatcgtcggacccctcctcttcacggcgatctatgcggcttctataacaacgtggaacgggtgggcatggattgcag
gcgctgccctctacttgctctgcctgccggcgctgcgtcgcgggctttggagcggcgcagggcaacgagccgatcgctga

>>MEG_7020|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaattctgagcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgt
tggtgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgctg
gccggcgccactgtcgactacgccatcatggcgacagtgcctttcctttgggttctctatatcgggcggatcgtggccgg
catcaccggggcgactggggcggtagccggcgcttatattgccgatatcactgatggcgatgagcgcgcgcggcacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgggcggtttctccccccac
gctccgttcttcgccgcggcagccttgaacggcctcaatttcctgacgggctgtttccttttgccggagtcgcacaaagg
cgaacgccggccgttacgccgggaggctctcaacccgctcgcttcgttccggtgggcccggggcatgaccgtcgtcgccg
ccctgatggcggtcttcttcatcatgcaacttgtcggacaggtgccggccgcgctttgggtcattttcggcgaggatcgc
tttcactgggacgcgaccacgatcggcatttcgcttgccgcatttggcattctgcattcactcgcccaggcaatgatcac
cgcccctgtagccgcccggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcacaggctacatcctgc
ttgccttcgcgacacggggatggatggcgttcccgatcatggtcctgcttgcttcgggtggcatcggaatgccggcgctg
caagcaatgttgtccaggcaggtggatgaggaacgtcaggggcagctgcaaggctcactggcggcgctcaccagcctgac
ctcgatcgtcggacccctcctcttcacggcgatctatgcggcttctataacaacgtggaacgggtgggcatggattgcag
gcgctgccctctacttgctctgcctgccggcgctgcgtcgcgggctttggagcggcgcagggcaacgagccgatcgctga

>>MEG_7021|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
gtgaaacccaacagacccctgatcgtaatactgtgcactgtcgcgctcgacgctgtcggcatcggcctgattatgccggt
gctgccgggcctcctgcgagatctggttcactcgaacgacgtcaccgcccactatggcattttgctggcgctgtatgcgt
tgatgcaatttgcctgcgcgcctgtgctgggtgcgctatcggatcgtttcggccggcggccggtcttgctcgtctcgctg
tccggcgccgctatcgactacgccatcatggcgacggcgcctttcctttgggttctctatatcgggcgcatcgtggccgg
catcaccggggcgactggtgcggtagccggcgcctatattgccgatatcacagatggggatgagcgcgcgcggtacttcg
gcttcatgagcgcctgtttcgggttcgggatggtcgcgggacctgtgctcggtgggctgatgagcagtttctccccccat
gctccgttcttcgccgcagcagccttgaatggcctcaatttcctgatgggcattttccttttgccggagtcgcacaaagg
cgaacgtcgaccattacgccgggaggctctcaacccgctcgcttcgttccggtgggtccggggcatgaccgtcatcgccg
ccctgatggctgtcttcttcatcatgcaactcgtcggacaggcgccggccacgctttgggtcatcttcggcgaggatcgc
tttcattgggacacgagcttgatcggcatttcgcttgccgcatttggtattctacattcactcgcccaggcaatgatcac
cggccctgtaaccaccaggctcggcgaaaggcgggcactcatgctcggaatgattgccgacggcgcaggctacatcctgc
ttgccttggcgacaaggggatggatggcgttcccgattatggtcctgcttgcttcgggtggcatcggaatgccggcgctg
caagcagtgttgtccaggcaggtagatgaggaacgtcaggggcagcttcaaggatctcttgcggcgctcaccagcctgac
ctcgatcgtcgggcccctcctcttcacggcgatctatgcggcctctataacaacgtggaacgggtgggcatggattgcag
gtgccgccctctacttgctctgcctgccggcgctgcgtcgcgggttttggagcggcgtagggcaacgagccgatcgctga

>>MEG_7022|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
atggcgcccgattacgcacgcacagacgcggtcgcacccgcaagtgtgaaggagaccttcgcgtacctctcggcgctgcc
caacgcgctggacagacgctggtgggcgggtctgctgctcatccaggcgctcatcgtcgccgtgtacaccacgcagtcga
acctgttcgggcgcagcgtcgacccgctcaccggaggcgaggtgccgctactgggcaccggcacccgcgcctttgtgtgg
actgttggactggcgttggcctgcatgctcgtcgagatgttcctgcgcgccctcggtaactacgtggtgggcctcaaggt
cgcccgcgcgtccatcgacttgcgccgtcgctgcctcgacgcgatcctgcgcgcacctgtgccgcgggtgatggagctcg
gcaccggcaacgtgatcacacgcatgaccaaggacatcgacgacgtcgtccaaaccatcaccgccatcggctcgcgcgtg
ctcaccaccgtgttcgtctttccgatcacgtttatcgggcttttgcttatcgacgtccgcttcgccttgatcctgctttt
gatctgcatctgcacgtacccgttcgcccgcgcggtggtccgcgccatcccggatgcctccaacgcggtgagcgtggcgg
aggcgcgtcgcaacgcggtgctgctggataccgtccggggcctgcccacgctgcgcgccttcgacttggagcgctgggcg
ttggcacggatgcggcggacctcgtggggcgcggtggaggcggagatggaccgtgtgcactggttcatccggctcacagg
catcggccaggtcgctttcgccgcgtgggtgctgctcacgcttggcgtcggcgcgtggctcgcgtcggccggagttgtca
cccgggcggcgcaacgtgctggaagacctctctgtcacgctcgaggcggaacaaccaccgcgctggtgggcacttcgggc
gccggcaagtccacgctcgccgcgctcattgcggggctggtggagcccacagctgggagcatccgggtaggggccgtgga
aacctcgcaggtcagcgacacgtggaccgccaagaacgtcaccctgctcacccaggacgtccacctgttcgccggcaccc
tgcgcgaggacctctcgatggccgcacaggatgcgaccgacgcggacctgctgcgggcgctggcaagtgtcgggctcgac
cctgaaggcacccagttcgcgcgcctgttcccgaaggggctggacaccgccgtcggcgcaggcgcggaggacataccccc
ggaggtggagcagcagctcgcgctcgcacgcgtggcgctgtcgggcccgaaggtgctcatcctggacgaggccacagcgg
aagccggcagcgacgccacgaacgcgctggaggacgccgccgcgcggatcaccgcagacaccacggcactggtggtggcg
caccgcctagaccaggcggcggccgcggaccggatcctggtcatggacgccgggcgcatcatcgaggacggcacccacac
cgaactcgtcgccgccgacgggagatacgcgcaactgttcgctgcgtggagtggcggcggtcactaa

>>MEG_7023|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
TTGAAAAAACCCATGCTGGTTATTTTGTTGACGGTGTTGCTGGATGCGGTGGGCATCGGTCTGATCATGCCTATTCTACC
GGCGCTGTTGCGCTCGCTGGGCGGTCTCGATGCCGGCAGCGTGCATTACGGCGCCCTGCTGGCGGCCTATGCGTTGATGC
AATTCCTGTTTTCGCCGATCCTCGGCGCGCTGAGCGATCGTTTCGGGCGGCGGCCGGTGCTGTTGATTTCGCTCGCCGGC
GCGGCGGCCGACTACCTGCTGATGGCGTTCGCGCCGACGCTGGCCTGGCTCTATCTGGGGCGGTTGCTGGCGGGCATCAC
CGGCGCCAACATGGCGGTCGCCACCGCTTACGTCACCGATATTACCCCCGTCGGCCAGCGCGCTCGGCGTTTCGGCCTGG
TGGGCGCGGTGTTCGGCGTCGGCTTTATCGTCGGCCCGCTGCTCGGCGGATCGCTGGGCGAATGGCATCTGCATGCGCCC
TTCCTGGCGGCGGCGATGATGAATGCCCTCAACCTGGTGATGGCGTTTTTCCTGCTGCCCGAATCGCGTAAATCCCGCCC
CCGCGCCGCCGAGAAAATTCGCCTTAATCCCTTCTCGTCATTGCGCCGGCTGCACGGCAAGCCTGGCCTGCTGCCGCTGG
CCGGCATTTATCTGGTTATGGCGCTGGTTTCGCAGGCGCCGGCCACGCTGTGGATTTTATACGGTCAGGATCGTTTCGGC
TGGAGCATGATGGTGGCGGGCCTGTCGCTGGCCGGCTACGGCGCCTGCCACGCGCTGTCGCAGGCCTTTGCCATCGGCCC
GCTGGTCGCGCGGCTCGGCGAGCGCAAGGCGCTGCTGATCGGCCTGGCCGCCGACGCCGTGGGCCTGGCGCTGTTGTCTG
TCGCCACGCGCGGCTGGGCGCCGTTCGCCCTGCTGCCGTTCTTCGCCGCGGGCGGCATGGCGTTGCCCGCACTGCAGGCG
CTGATGGCGCACAAGGTGGACGACGATCATCAGGGCGAGCTGCAAGGGACGCTCGCCAGCATGGGCAGCCTGATCGGCGT
CGCGGGGCCGCTGGTGGCGACGGCGCTGTATGCCGCCACGCGCGATGTCTGGCCTGGGCTGGTGTGGGCGTTGGCCGCCG
CCCTGTACCTGGTGGTGCCGCCGCTGCTGGCACGCTCACGCGCCAGGGATGCGGCGCCATAA

>>MEG_7024|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
ATGTCCACCAACTTATCAGTGATAAAGAATCCGCGCGTTCAATCGGACCAGCGGAGGCTGGTCCGGAGGCCAGACGTGAA
ACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGTGCTGC
CGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGTTGATG
CAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTGGCCGG
CGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGGCATCA
CCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCGGCTTC
ATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCACGCTCC
GTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGGCGAAC
GCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCGCCCTG
ATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGCTTTCA
CTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCACCGGCC
CTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGCTTGCC
TTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTGCAAGC
AATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGACCTCGA
TCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAGGCGCT
GCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>>MEG_7025|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
ATGTCCACCAACTTATCAGTGATAAAGAATCCGCGCGTTCAATCGGACCAGCGGAGGCTGGTCCGGAGGCCAGACGTGAA
ACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGTGCTGC
CGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGTTGATG
CAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTGGCCGG
CGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGGCATCA
CCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCGGCTTC
ATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCACGCTCC
GTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGGCGAAC
GCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCGCCCTG
ATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGCTTTCA
CTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCACCGGCC
CTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGCTTGCC
TTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTGCAAGC
AATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGACCTCGA
TCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAGGCGCT
GCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGAAATTCTTCAAATTCCCGTTGCACATAG

>>MEG_7026|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
GTGAAACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGATGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTG
GCCGGCGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GGTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATTTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>>MEG_7027|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTGCAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGGTAGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAACTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGGTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCGGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAAATTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCG
CATTTTTTACAAGATACTACACTTCCTAAGCTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGTATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAAAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATGAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAACTC
TAGAGCTACTGTACTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCAATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGCATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA

>>MEG_7028|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
GTGAAACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGATGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTG
GCCGGCGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACATTGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCTTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>>MEG_7029|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
GTGAAACCCAACATACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGGTGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCAATCTTGCTCGTCTCGCTG
GCCGGCGCCACTGTCGACTACGCCATCATGGCGACAGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCAGCTTCGTTCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGCCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>>MEG_7030|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
TGGATTGCGGAGGAAGAGAAGAATAAAGATTTAGATGAAATTTATATAAAGGGAGCACAAGCAGGGCAGATAGGAGCATT
TATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGGCTTCCTATTATAGTTAGTGGAGTTTTATTTATAA
TTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAAACCATCTGCTCCTGGGGATTTAAATACATTCAAA
AAGATGGTATATACATTTAAATCTGGTCTTAAAATTGTAAAAAGTAAATCTATAATTATGATTTTACTTGCAGTAACTTT
ATTTTATGGATTATCAAGCGAAGGTTATGATAGACTTTCTAATGCACATTTTTTACAAGATACTACACTTCCTAAGCTTG
GAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGGAATGATATTGAGCTTCATAGTAATGCATTTTATG
GCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTATTATTATGTATAAATATACTTTATATATCGTCTAT
GTTGATATTTGCTCTTACAAAAAACTTTAGTTTAATGTTAATAGCTTATTTGGCAACAAATACCTTTAGAATTATAAATG
AACCTATATTCAGTGCGTGGTTAAATGGGCATATA

>>MEG_7031|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTGCAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGGTAGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAACTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGGTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCAGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAAATTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCA
CATTTTTTACAAGATACTACACTTCCTAAGCTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGTATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAAAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATGAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAACTC
TAGAGCTACTGTACTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCAATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGCATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA

>>MEG_7032|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
GTGAAACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGATGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTG
GCCGGCGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>>MEG_7033|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
GTGAAACCCAACATACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGGTGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCAATCTTGCTCGTCTCGCTG
GCCGGCGCCACTGTCGACTACGCCATCATGGCGACAGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>>MEG_7034|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TETA
ATGAAGACGTACAGCTGGTTCGTCCCGCCCGCGCCGCCAGCGGACGATCCGGCGCGGCTCCACCCAGCACGCTGGAGCAG
CGGGAACCGTGTGGTCAGGGACATGGTAGGCGCATACCCGGGCGTGCTAGTGCTGCACATTCTGAGCTACCTCATCGGCT
CCGGCATCTCCGCGTTTGTGCCGGTGGTGGTGGGCATGATCGTGGACGGCCTGGTGGGGGAAGAAAAGTTCAACGCATGG
TGGCTCTTCGCAGTATTGGTCGGCATCTTCATCATCCAGTTCATCGGCGAGGCCACCGGCGACGGCCTGGCCACAGCCTC
GGTGCGCCGCGTGACCCACAACGCGCAGCAGCACCTGTCCTCGGGCGTGCTGCGCCGCGGGGCGGGAGCGATGAGCCCCG
GCACCGTACTCAACACCATCGACGCGGACGCGAACACCGTCGGCCGCTACCGCGAGCTGCTGTCGTTTCCGCTCATGGCC
ATCGGCTACGCGGTCTGCGCGATGGTGGCGATGTGGTCGGTCTCCCCGTGGATCTCACTGGCCATCCCGGCCAGCGCGCT
GATCATCGCTCTGTTCGCCGCGTGGACCGCGGGGCCGGTGACGCGGGTGTCGTTGAAGCGTCGCGCCGCGGAGGCGGATG
TCGCTGGCTTGGCCACGGATGCGTCGCAAGGCATTCGCACCGTCAAAGGCCTAGGCGCGGGTGCAACCGTGGCAACACGT
TTTCACGCCGAAACGGCGAAGGCGAACGGCTTGATGCTCACGCACCTGCGTGTGGAGGTGTGGCTCGGTTTCGCCAGGTT
TTGCGTGGCGTGGCTGTGCAACCTTGGCATCGTGGGCTTGAGCGCGTGGATGACGCTGCGCGGGGAGATCACCCCGGGGC
AGCTGACATCCGTGGCACTGTTGGTGCAGCCTGCGTTGACCATGGCGGGCTTAGCGTTCGGCGACCTGGCCAGCGGGTGG
GGCAGGGCCGTCGCGAGTGGCCAGCGCATCGAGCAGCTGCACCACGCGGGCGATGACGCGGCGGGGCCTGAGCCGACAGA
CACCCCGGTCCCAGGCGCGGGGCTGTGGATTCTCGAGCCGGCGGAGCGTTCCTACGCCACCGCCGCCGCGTGGGCGCAGC
GCGCAGACGTGCTGTTCCCGCCGCACACCGTCAACGTGTTTGAGGGCACCATCGCAGACAACGTGAACCCGCGCGGGGAT
GTGCCGGAGGACGTCGTCAAGCAGGCGCTCGCCGCCGCCCACTGCCAAGACATCCTCCGCAGGCTCGGCGGTATCAACGA
AGCAGGCGAGTTGCCGGACGCGCCGCTGGGGGAGGCCGGCCTGAACCTTTCCGGCGGGCAGCGCCAGCGCGTCGCGCTTG
CCAGGGCGCTCGCCGCCGACCCGGAGGTGCTCATCCTGGACGACCCGACCACGGGGCTCGATTCCGTGACACAGGCGGAC
GTCGTGGCAGCCGTCGCCGCGCTCAGAGCAGACAAAACCACCGTGGTCATCACCGGAAACGCCGCGTGGCAGCACGCTGG
AACCGAATTGGAGGTGGCGTAG