MEGAResFrom MEG, the Microbial Ecology Group

TET43

The tet43 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6996|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET43
ATGCCCCCATCTCACCACATGTTGCGCCCAATCGAACAATGTTCTATTCTATGGAACGACGTTCGATACTCGAACAGCGT
TCGACTGAAGGAGGCCGGTATGACCGCCACAACTCAAGCCTCGGCACCCGCGGCACGTACCTATCTGTCGCTGCGCGCCG
CGTGGATTCCGCTCTTCGCGCTCTGCCTCGCGTTCTTCGTGGAGATGGTTGACAACACCCTGCTCACGATCGCGCTGCCG
ACGATCGGGCGCGACCTCGGCGCGAGCGTCACCTCCTTGCAGTGGGTGACCGGCGCCTATTCGCTGACCTTTGGCGGCCT
GTTGCTGACAGCGGGCTCGCTCGCCGACCGCTTTGGCCGGCGCCGCGTGCTGCAGATTGGCCTTCTCGCCTTTGGGCTCA
TCAGCCTCACGGTGATTGCCGTGGCAACCGCGGGCCAGCTGATCGCGGTGCGCGCTGCGCTCGGCCTCGCCGCCGCCGCG
ATGGCCCCAATCACCAACTCCCTCGTGTTCAGGCTGTTCGAGGGCGAGGACCTCCGTCGGCGGGCAATGACCCTCATGAT
CGTCGTCGGCATGAGCGGATTCATCCTTGGCCCGCTACTCGGCGGAACGGTTCTCGCTCACGCCAGCTGGCAGTGGTTGC
TGCTTATCAACGCACCCATCGCGCTCATTGCGCTCATCGGCGTTCGCCTTGGCGTGCCTGCGGACGACGCCGAGGGACTC
ACAAAGGACCGCCTTGACGTGAAGGGCTCGGCACTCAGCATCGCCGCGATCGGCCTCGCTTGCTACACACTCACGAGCGG
AGTGGAGCACGGCTGGATGTCTGCCGTCACCTGGGCCTGCGGGATCGGCGCGGCTGCCGCGCTGATGGGATTCGTGTGGC
ACGAGCGCCGCACCGATCACCCCATGCTGGACCTCGACGTCTTCAGGAACCGCACCGTTCGCGGCGCATCGATCGCCCAG
GTAGGCACCTCAATCGCGATGGCTTCGCTGATGTTCGGCCTGATCCTTCACTTCCAGGGCGCGTACGGCTGGAGCCCCAT
GCGCGCCGGCCTCGCCAACCTGCCGCTCATCCTCACGATGATTCTTGCGACACCGGTCTCTGAGGGCCTCGCGAAGAGGT
TCGGCCACCGCATTGCCATGCTCATCGGCGCGGGTCTCCTCGCCGGATCGCTCGCTGGCCTCGCGTGGGGCGTGGGGCAT
GGSTACCTCGTCATCGCGGTATTCATGGTGACCTTCACCCTCGGTCTCCGCACCGTTATGACGATCGCGGCGGTGGGCCT
CGTTGGTGCGATGCCGGAGAACCGCACCTCGCTCGGCGCGGCACTCAACGACACCGCCCAAGAAGTAGGAACAAGCCTCG
GCATGGCAGTGATCGGCACGCTCATCGCGGTGCTCGYCACCACGACGCTTCCCAACGGCGACKGGAGCCTCGACCTCGCG
ACTTCATACTTCGCCGGGGAGCGCATCGCTTATCTGTTCCTTGCCGTCGTAGTCGGAGTGATCGCGGGATGGGGCGCGCT
CACGTTGTCCAACTCCAAGGAGATGGAAGACGTCCACTAG