MEGAResFrom MEG, the Microbial Ecology Group

TET42

The tet42 gene encodes a tetracycline efflux pump.

References

  • #N/A

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6995|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET42
ATGACTTCACCCACCTCTCTCACGCGACGGGACCAGAACCGCGCGTGGATCATGCTCATCGTGCTCACGATGCTCACCGT
CATCGGAATGACGGTCGTCCTCCCGGTCCTGCCCTTCGTCGTGCTCCAGTACGTCTCGCACGAGAGCGACCTGGCCATCT
GGGTCGGCGTGCTCGAAGCGATCAACGGCCTCTGCGCCTTCCTGGTCGCGCCCTTCCTCGGACGTCTCTCAGACCGCTTC
GGACGTCGACCCGTGATCATCGTCGCGGCATTCGGTGCGGCCTTCTCGATGGCGCTGTTCGGATTCGGCGGCGCCCTCTG
GGTGCTCGTGCTCGCTCGCGTCATCCAGGGCCTCACCGCGGGCGATCTACCCGCCCTCTTCGCCTACCTGGCCGACATCA
CCCCGCCGGAGCAGCGCGCCAAGCGCTTCGGCCTCCTCGGTGCGCTCTCGGGGATCGGCACCATGATCGGTCCAGCCATC
GGAGGACTGCTCGCCGCGATCAGCATCCAGCTCCCGGTGTTCCTGACCGCCGCCGTCGCCCTCACGATCGCGATCCTCAG
CATCTTCCTCCTCCCGGAGAGCCTGAAGCCGGGCAACAGGATCACCGCGATCAAGCTGCGCGACGTGCAGCCCTTCGCCG
TCTTCAAGGAGGCCTTCGGACGCAAGGAGCTGCGCGGGCTGATGATCGGCTTCGGCCTGCTCGCGCTGCCGTTCGGCTTC
TTCGTGAACAACTTCAGCGTGCTCGCCCTGGACTCCATCCAGTGGGGACCGACCCAGATCGGACTCCTGACCGCGGCCGT
CGGCATCATCGACATCCTCATCCAGGGCGTGCTGCTGGGCATCCTGCTTCCGCGCATCGGCGAGCGCGGAGTGATCGTGA
GCGGCATCGTCGCGCAGATGATCGGTCTCGCGGCCCTCGCCGTCGTGGCTTCCGTCTTCGCGCAGCCGTGGGTGTTCATC
GTCGGCGCCCTGATGCTGGCCGCCGGCCAGGGGGCGTCCCAGGCCGCGATGGACGGGGCGATGTCCAACGCCGTCGGCGA
CGACGAGCAGGGCTGGCTCGGCGGAGCCACCCAGTCGTTGAATGCGGCGATGGGCACGGCAGCCCCGCTCATCGCCGGTG
CGCTCTACGCACTGGTCAGCCACGCGGCCCCGTACTGGCTCGGGGTCGCGCTCATGATCGTGGCGGTGACCGTCGTCAGC
CGCGCGCACATCGCGAACACCGCGAAGCGCCCGGCCGGCGAGACGACGGGCGACGCTCCCGCGGCACTCGTGGAGACGGC
TGGCTGA