MEGAResFrom MEG, the Microbial Ecology Group

TET39

The tet39 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6987|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET39
GTGAAGAAATCATTGAGCGTGATTTTAATCACTATATTTCTGGATGCTGTTGGGATTGGTTTAATTATGCCGATCTTGCC
TGAATTATTACGGTCATTGGCTGGAGCTGAAGCAGGCGGTGTTCACTATGGTGCTTTATTAGCTGTGTATGCTCTGATGC
AGTTCATTTTTGCACCTATCCTTGGAGCGTTGAGTGACCGATTTGGACGTCGACCTGTATTAATTATTTCAATTGCTGGT
GCAACGGCTGATTATCTCCTAATGGCTGCTGCTCCTTCTCTATTGTGGCTATATATTGGTCGTATTTTTGCGGGAATTAC
AGGTGCCAACATGGCTGTTGCAACAGCTTATGTTTCAGATATTACTCCAGCCCATGAGCGTGCAAAAAGGTTTGGTCTCC
TTGGAGCTGTCTTTGGTATTGGGTTTATAGCGGGTCCGGTAATAGGTGGAGTTTTGGGTGAATGGAACTTACATGCACCG
TTCTTTGCTGCTGCTTTTATGAATGGGATTAATTTAATAATGACAGCAGTCTTATTAAAAGAATCAAAACACAGCAATAA
AATGACTGAGAAGGTTCAGGAGCAATCAATATTAAAGAAATTATCCTATTTGATCACTCAACCTAATATGGCTCCATTGC
TTGGTATCTTTTTAATTATCACATTGGTTTCACAAGTCCCCGCAACTTTATGGGTTATCTATGGGCAGGATCGTTATGGC
TGGAGTATATTTATTGCAGGTGTTTCCCTTGCTAGTTATGGAATATGCCATTCTATTGCACAGGCTTTTGCTATCGCCCC
TATGGTAAAGAGGTTTGGAGAGAAAAATACGTTGTTATGTGGAATAGCTTGCGATGCAATTGGTTTACTTCTTTTATCTA
TTGCTGTTGAAGAATGGGTGCCTTTTGCGTTGTTACCATTGTTTGCCCTTGGTGGAGTAGCCGTTCCTGCTTTGCAAGCA
ATGATGTCCAGAGGTATTAGTGATGAAAGACAAGGTGAATTACAAGGGCTATTAAGCAGTTTTAATAGTCTGGGGGCTAT
AATTGGTCCTGTATTAGTTACTAGCCTCTATTTTATGACTCAGGCATCAGCTCCTGGAATGGTATGGGCATTAGCTGCAA
TACTTTATGTAATCACCCTACCCTTATTGCTTAAGTATCGCCTGAATAAATATTCTGGAGTTCCATAA

>>MEG_6988|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET39
AATTGGTCGTATTTTTGCGGGAATTACAGGTGCCAACATGGCTGTTGCAACAGCTTATGTTTCAGATATTACTCCAGCCC
ATGAGCGTGCAAAAAGGTTTGGTCTCCTTGGAGCTGTCTTTGGTATTGGGTTTATAGCGGGTCCGGTAATAGGTGGAGTT
TTGGGTGAATGGAACTTACATGCACCGTTCTTTGCTGCTGCTTTTATGAATGGGATTAATTTAATAATGACAGCAGTCTT
ATTAAAAGAATCAAAACACAGCAATAAAATGACTGAGAAGGTTCAGGAGCAATCAATATTAAAGAAATTATCCTATTTGA
TCACTCAACCTAATATGGCTCCATTGCTTGGTATCTTTTTAATTATCACATTGGTTTCACAAGTCCCCGCAACTTTATGG
GTTATCTATGGGCAGGATCGTTATGGCTGGAGTATATTTATTGCAGGTGTTTCCCTTGCTAGTTATGGAATATGCCATTC
TATTGCACAGGCTTTTGCTATCGCCCCTATGGTAAAGAGGTTTGGAGAGAAAAATACGTTGTTATGTGGAATAGCTTGCG
ATGCAATTGGTTTACTTCTTTTATCTATTGCTGTTGAAGAATGGGTGCCTTTTGCGTTGTTACCATTGTTTGCCCTTGGT
GGAGTAGCCGTTCCTGCTTTGCAAGCAATGATGTCA

>>MEG_6989|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET39
CACTAATACCTCTGGACATCATTGCTTGCAAAGCAGGAACGGCTACTCCACCAAGGGCAAACAATGGTAACAACGCAAAA
GGCACCCATTCTTCAACAGCAATAGATAAAAGAAGTAAACCAATTGCATCGCAAGCTATTCCACATAACAACGTATTTTT
CTCTCCAAACCTCTTTACCATAGGGGCGATAGCAAAAGCCTGTGCAATAGAATGGCATATTCCATAACTAGCAAGGGAAA
CACCTGCAATAAATATACTCCAGCCATAACGATCCTGCCCATAGATAACCCATAAAGTTGCGGGGACTTGTGAAACCAAT
GTGATAATTAAAAAGATACCAAGCAATGGAGCCATATTAGGTTGAGTGATCAAATAGGATAATTTCTTTAATATTGATTG
CTCCTGAACCTTCTCAGTCATTTTATTGCTGTGTTTTGATTCTTTTAATAAGACTGCTGTCATTATTAAATTAATCCCAT
TCATAAAAGCAGCAGCAAAGAACGGTGCATGTAAGTTCCATTCACCCAAAACTCCACCTATTACCGGACCCGCTATAAAC
CCAATACCAAAGACAGCTCCAAGGAGACCAAACCTTTTTGCACGCTCATGGGCTGGAGTAATATCTGAAACATAAGCTGT
TGCAACAGCCATGTTGGCACCTGTAATTCCCGCAAAAATACGACCAATATATAGCCACAATAGAGAAGGAG

>>MEG_6990|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET39
ATGCCGATCTTGCCTGAATTATTACGGTCATTGGCTGGAGCTGAAGCAGGCGGTGTTCACTATGGTGCTTTATTAGCTGT
GTATGCTCTGATGCAGTTCATTTTTGCACCTATCCTTGGAGCGTTGAGTGACCGATTTGGACGTCGACCTGTATTAATTA
TTTCAATTGCTGGTGCAACGGCTGATTATCTCCTAATGGCTGCTGCTCCTTCTCTATTGTGGCTATATATTGGTCGTATT
TTTGCGGGAATTACAGGTGCCAACATGGCTGTTGCAACAGCTTATGTTTCAGATATTACTCCAGCCCATGAGCGTGCAAA
AAGGTTTGGTCTCCTTGGAGCTGTCTTTGGTATTGGGTTTATAGCGGGTCCGGTAATAGGTGGAGTTTTGGGTGAATGGA
ACTTACATGCACCGTTCTTTGCTGCTGCTTTTATGAATGGGATTAATTTAATAATGACAGCAGTCTTATTAAAAGAATCA
AAACACAGCAATAAAATGACTGAGAAGGTTCAGGAGCAATCAATATTAAAGAAATTATCCTATTTGATCACTCAACCTAA
TATGGCTCCATTGCTTGGTATCTTTTTAATTATCACATTGGTTTCACAAGTCCCCGCAACTTTATGGGTTATCTATGGGC
AGGATCGTTATGGCTGGAGTATATTTATTGCAGGTGTTTCCCTTGCTAGTTATGGAATATGCCATTCTATTGCACAGGCT
TTTGCTATCGCCCCTATGGTAAAGAGGTTTGGAGAGAAAAATACGTTGTTATGTGGAATAGCTTGCGATGCAATTGGTTT
ACTTCTTTTATCTATTGCTGTTGAAGAATGGGTGCCTTTTGCGTTGTTACCATTGTTTGCCCTTGGTGGAGTAGCCGTTC
CTGCTTTGCAAGCAATGATGTCCAGAGGTATTAGTGATGAAAGACAAGGTGAATTACAAGGGCTATTAAGCAGTTTTAAT
AGTCTGGGGGCTATAATTGGTCCTGTATTAGTTACTAGCCTCTATTTTATGACTCAGGCATCAGCTCCTGGAATGGTATG
GGCATTAGCTGCAATACTTTATGTAATCACCCTACCCTTATTGCTTAAGTATCGCCTGAATAAATATTCTGGAGTTCCAT
AA