MEGAResFrom MEG, the Microbial Ecology Group

TET38

The tet38 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6981|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET38
atgaatgttgaatattctaaaataaagaaagcagtacctattttattattcttatttgtattcagtttggttatagacaa
ctcattcaaattgatttctgtagccattgctgatgacttaaacatttcagtaacgacagtaagttggcaagcgacattag
ccggtttagtaattggtattggcgctgtagtatacgcttcattatctgatgccattagtatacgcacactatttatttat
ggcgtgatattaatcattatcggatcaattattggttacattttccaacatcaattcgcattacttttagttggacgtat
tattcaaactgcaggtttagctgctgcagagacattatatgtgatatatgttgcaaagtatctttctaaagaggaccaga
agacttaccttggcttaagtacgagcagttattccttgtcattagttatcggtacattatcaggtggatttatttctacg
tatttacactggacaaatatgtttttaattgcattaatcgtagtatttacgttgccattcctatttaaattattaccaaa
agaaaataatacaaataaagctcatttagattttgttggcttaattctagtggcaactatcgctacaacagttatgctgt
ttattacgaactttaattggttatatatgattggtgccttaattgcgattatcgtttttgcgctatatattaaaaatgcg
caacgtccattagtaaacaaatcatttttccaaaataaacgttatgcttcatttttatttatagtatttgtaatgtatgc
catccaattgggttatatttttacgttcccattcataatggaacaaatttatcatcttcagctagacacaacatcactgc
tattagtaccgggttatattgtagcagtcatcgttggtgcactaagtggtaaaatcggcgaatatcttaattcaaaacaa
gcgattatcacagcaattattttaatcgcactgagcttgattttacctgcatttgcagtaggtaatcacatttcaatctt
cgtcatttctatgatattctttgcaggtagctttgctttaatgtatgcacctttacttaacgaagccattaaaacaatag
atcttaatatgacaggtgtggctattggtttttataatttaattattaatgtggcggtatctgtaggtattgcgattgct
gcggctttaatcgattttaaagcattaaatttcccaggcaatgatgcattaagttcacatttcggtattattttaattat
tttaggtttaatgagtattgtcggattagttttattcgtcatcttaaatcgttggacacaatctgaaaaataa

>>MEG_6982|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET38
atgaatgttgaatattctaaaataaagaaagcagtacctattttattattcttatttgtattcagtttggttatagacaa
ctcatttaaattgatttctgtagccattgctgatgacttaaacatatctgtaacgacagtaagttggcaagcgacattag
ccggtttagtaattggtattggcgctgtagtatacgcttcattatctgatgccattagtatacgcacactatttatttat
ggcgtgatattaatcattatcggatcaattattggttacattttccaacatcaattcccattacttttagttggacgtat
tattcaaactgccggtttagctgctgcagagacattatatgtgatatatgttgcaaagtatctttctaaagaggaccaga
agacttaccttggcttaagtacgagcagttattccttgtcattagttatcggtacattatcaggtggatttatttctacg
tatttacactggacaaatatgtttttaattgcattaatcgtagtatttacgttgccattcctatttaaattattaccaaa
agaaaataatacgaataaagctcatttagattttgttggcttaattctagtggcaactattgctacaacagtcatgctgt
ttattacgaactttaattggttatatatgattggtgccttaattgcgattatcgtttttgcgctatatattaaaaatgcg
caacgtccattagtaaataaatcatttttccaaaataaacgttatgcttcatttttatttatagtatttgtaatgtatgc
tatccaattgggttatatttttacgttcccattcataatggagcaaatttatcatctgcaactagacacaacatcactgt
tattagtaccgggttatatagtagcagtcattgttggtgcactaagtggtaaaatcggcgaatatctgaattcaaaacaa
gcgattatcacagcaattattttaatagcactgagcttgattttacctgcatttgcagtaggtaatcacatttcaatctt
cgtcatttctatgatattctttgcaggtagctttgctttaatgtatgcacctttacttaacgaagccattaaaacaatag
atcttaatatgacaggtgtggctattggtttttataatttaattattaatgtggcggtatctgtaggtattgcgattgct
gcggctctaatcgattttaaagcattaaatttcccaggcaatgatgcattaagttcacatttcggtattattttaattat
tttaggtttaatgagtattgtcggattagttttattcgtcagcttaaatcgttggacacaatctgaaaaataa

>>MEG_6983|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET38
atgaatgttgaatattctaaaataaagaaagcagtacctattttattattcttatttgtattcagtttggttatagacaa
ctcatttaaattgatttctgtagccattgctgatgacttaaacatttctgtaacgacagtaagttggcaagcgacattag
ccggtttagtaattggtattggcgctgtagtatacgcttcattatctgatgccattagtatacgcacactatttatttat
ggcgtgatattaatcattatcggatcaattattggttacattttccaacatcaattcgcattacttttagttggacgtat
tattcaaactgccggtttagccgctgcagagacattatatgtgatatatgttgcaaagtatctttctaaagaggaccaga
agacttaccttggcttaagtacgagcagttattccttgtcattagttatcggtacattatcaggtggatttatttctacg
tatttacactggacaaatatgtttttaattgcattaatcgtagtatttacgttgccattcctatttaaattattaccaaa
agaaaataatacgaataaagctcatttagattttgttggcttaattctagtggcaactattgctacaacagtcatgctgt
ttattacgaactttaattggttatatatgattggtgccttaattgcgattatcgtttttgcgctatatattaaaaatgcg
caacgtccattagtaaataaatcatttttccaaaataaacgttatgcttcatttttatttatagtatttgtaatgtatgc
tatccaattgggttatatttttacgttcccattcataatggagcaaatttatcatctgcaactagacacaacatcactgt
tattagtaccgggttatatagtagcagtcatcgttggtgcactaagtggtaaaatcggcgaatatctgaattcaaaacaa
gcgattatcacagcaattattttaatcgcactgagcttgattttacctgcatttgcagtaggtaatcacatttcaatctt
cgtcatttctatgatattctttgcaggtagctttgctttaatgtatgcacctttacttaacgaagccattaaaacaatag
atcttaatatgacaggtgtggctattggtttttataatttaattattaatgtggcggtatctgtaggtattgcgattgct
gcggctctaatcgattttaaagcattaaatttcccaggcaatgatgcattaagttcacatttcggtattattttaattat
tttaggtttaatgagtattgtcggattagttttattcgtcagcttaaatcgttggacacaatctgaaaaataa

>>MEG_6984|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET38
ATGAATGTTGAATATTCTAAAATAAAGAAAGCAGTACCTATTTTATTATTCTTATTTGTATTCAGTTTGGTTATAGACAA
CTCATTTAAATTGATTTCTGTAGCCATTGCTGATGACTTAAACATATCTGTAACGACAGTAAGTTGGCAAGCGACATTAG
CCGGTTTAGTAATTGGTATTGGCGCTGTAGTATACGCTTCATTATCTGATGCCATTAGTATACGCACACTATTTATTTAT
GGCGTGATATTAATCATTATCGGATCAATTATTGGTTACATTTTCCAACATCAATTCCCATTACTTTTAGTTGGACGTAT
TATTCAAACTGCCGGTTTAGCTGCTGCAGAGACATTATATGTGATATATGTTGCAAAGTATCTTTCTAAAGAGGACCAGA
AGACTTACCTTGGCTTAAGTACGAGCAGTTATTCCTTGTCATTAGTTATCGGTACATTATCAGGTGGATTTATTTCTACG
TATTTACACTGGACAAATATGTTTTTAATTGCATTAATCGTAGTATTTACGTTGCCATTCCTATTTAAATTATTACCAAA
AGAAAATAATACGAATAAAGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATTGCTACAACAGTCATGCTGT
TTATTACGAACTTTAATTGGTTATATATGATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCG
CAACGTCCATTAGTAAATAAATCATTTTTCCAAAATAAACGTTATGCTTCATTTTTATTTATAGTATTTGTAATGTATGC
TATCCAATTGGGTTATATTTTTACGTTCCCATTCATAATGGAGCAAATTTATCATCTGCAACTAGACACAACATCACTGT
TATTAGTACCGGGTTATATAGTAGCAGTCATTGTTGGTGCATTAAGTGGTAAAATCGGCGAATATCTGAATTCAAAACAA
GCGATTATCACAGCAATTATTTTAATAGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTT
CGTCATTTCTATGATATTCTTTGCAGGTAGCTTTGCTTTAATGTATGCACCTTTACTTAACGAAGCCATTAAAACAATAG
ATCTTAATATGACAGGTGTGGCTATTGGTTTTTATAATTTAATTATTAATGTGGCGGTATCTGTAGGTATTGCGATTGCT
GCGGCTCTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTAAGTTCACATTTCGGTATTATTTTAATTAT
TTTAGGTTTAATGAGTATTGTCGGATTAGTTTTATTCGTCATCTTAAATCGTTGGACACAATCTGAAAAATAA

>>MEG_6985|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET38
ATGAATGTTGAATATTCTAAAATAAAGAAAGCAGTACCTATTTTACTATTCTTATTTGTATTCAGTTTGGTTATAGACAA
CTCATTTAAATTGATTTCTGTAGCCATTGCTGATGACTTAAACATTTCTGTAACGACAGTAAGTTGGCAAGCGACATTAG
CCGGTTTAGTAATTGGTATTGGCGCTGTAGTATACGCTTCATTATCTGATGCCATTAGTATACGCACACTATTTATTTAT
GGCGTGATATTAATCATTATCGGATCAATTATTGGTTACATTTTCCAACATCAATTCGCATTACTTTTAGTTGGACGTAT
TATTCAAACTGCAGGTTTAGCTGCTGCAGAGACATTATATGTGATATATGTTGCAAAGTATCTTTCTAAAGAGGACCAGA
AGACTTACCTTGGCTTAAGTACGAGCAGTTATTCCTTGTCATTAGTTATCGGTACATTATCAGGTGGATTTATTTCTACG
TATTTACACTGGACAAATATGTTTTTAATTGCGTTAATCGTAGTATTTACGTTGCCATTCCTATTTAAATTATTACCAAA
AGAAAATAATACAAATAAAGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATCGCTACAACAGTCATGCTGT
TTATTACGAACTTTAATTGGTTATATATGATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCT
CAACGTCCATTAGTAAACAAATCATTTTTCCAAAATAAACGTTATGCTTCATTTTTATTTATAGTATTTGTAATGTATGC
CATCCAATTGGGTTATATTTTTACGTTCCCATTCATAATGGAACAAACTTATCATCTTCAACTAGACACAACATCACTGT
TATTAGTACCGGGTTATATTGTAGCAGTCATCGTTGGTGCACTAAGTGGTAAAATCGGCGAATATCTTAATTCAAAACAA
GCGATTATCACAGCAATTATTTTAATCGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTT
CGTCATTTCTATGATATTCTTTGCAGGTAGCTTTGCTTTAATGTATGCACCTTTACTTAACGAAGCCATTAAAACAATAG
ATCTTAATATGACAGGTGTGGCTATTGGTTTTTATAATTTAATTATTAATGTGGCGGTATCTGTAGGTATTGCGATTGCT
GCGGCTCTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTAAGTTCACATTTCGGTATTATTTTAATTAT
TTTAGGTTTAATGAGTATTGTCGGATTAGTTTTATTCGTCATCTTAAATCGTTGGACACAATCTGAAAAATAA

>>MEG_6986|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET38
ATGAATGTTGAATATTCTAAAATAAAGAAAGCAGTACCTATTTTATTATTCTTATTTGTATTCAGTTTGGTTATAGACAA
CTCATTCAAATTGATTTCTGTAGCCATTGCTGATGACTTAAACATTTCAGTAACGACAGTAAGTTGGCAAGCGACATTAG
CCGGTTTAGTAATTGGTATTGGCGCTGTAGTATACGCTTCATTATCTGATGCCATTAGTATACGCACACTATTTATTTAT
GGCGTGATATTAATCATTATCGGATCAATTATTGGTTACATTTTCCAACATCAATTCGCATTACTTTTAGTTGGACGTAT
TATTCAAACTGCAGGTTTAGCTGCTGCAGAGACATTATATGTGATATATGTTGCAAAGTATCTTTCTAAAGAGGACCAGA
AGACTTACCTTGGCTTAAGTACGAGCAGTTATTCCTTGTCATTAGTTATCGGTACATTATCAGGTGGATTTATTTCTACG
TATTTACACTGGACAAATATGTTTTTAATTGCATTAATCGTAGTATTTACGTTGCCATTCCTATTTAAATTATTACCAAA
AGAAAATAATACAAATAAAGCTCATTTAGATTTTGTTGGCTTAATTCTAGTGGCAACTATCGCTACAACAGTTATGCTGT
TTATTACGAACTTTAATTGGATATATATGATTGGTGCCTTAATTGCGATTATCGTTTTTGCGCTATATATTAAAAATGCG
AAACGTCCATTAGTAAACAAATCATTTTTCCAAAATAAACGTTATGCTTCATTTTTATTTATAGTATTTGTAATGTATGC
CATCCAATTGGGTTATATTTTTACGTTCCCATTCATAATGGAACAAATTTATCATCTTCAGCTAGACACAACATCACTGC
TATTAGTACCGGGTTATATTGTAGCAGTCATCGTTGGTGCACTAAGTGGTAAAATCGGCGAATATCTTAATTCAAAACAA
GCGATTATCACAGCAATTATTTTAATCGCACTGAGCTTGATTTTACCTGCATTTGCAGTAGGTAATCACATTTCAATCTT
CGTCATTTCTATGATATTCTTTGCAGGTAGCTTTGCTTTAATGTATGCACCTTTACTTAACGAAGCCATTAAAACAATAG
ATCTTAATATGACAGGTGTGGCTATTGGTTTTTATAATTTAATTATTAATGTGGCGGTATCTGTAGGTATTGCGATTGCT
GCGGCTTTAATCGATTTTAAAGCATTAAATTTCCCAGGCAATGATGCATTAAGTTCACATTTCGGTATTATTTTAATTAT
TTTAGGTTTAATGAGTATTGTCGGATTAGTTTTATTCGTCATCTTAAATCGTTGGACACAATCTGAAAAATAA