MEGAResFrom MEG, the Microbial Ecology Group

TET35

The tet35 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6977|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET35
atgaatttaatagatttttctcattctcctgtttcattattgcctcctattgttgctctgacattggcgattctgactcg
acgtgtattagtttctcttggtgtaggtatcgcgcttggtgcggttctacttaacagctggtcaattggtggtactgcaa
gctatgtaggtactcaagtgtcttctgtcttcattgaagatggtggaattaacacttggaacatgagcattgttggtttc
ctaattctattaggcatgacaacggctctattgacactttctggcggtactcgcgcattcgctgaatgggcacagtctcg
tgtgaaaagtaaacgcggctctaaacttcttgcagcctttttaggcgtattcatttttgtcgacgattactttaatagtc
ttgctgtaggtgcgatttcacgcccagtaacggatcgcttctatgtatctcgtgcgaaactggcttacatcctagattca
accgctgcacctatgtgtgtcatcatgcctgcttctagttggggtgcttacatcatcactatcatcggcggtattttagt
atcacacggtattactgagtattcagcgcttggggcgtatgtgcgtcttatcccaatgaacttctacgctgtatttgcgc
tgttaatggtgtttgcagtagcgtggtttggtctggatatcggtaagatgcgcgagcatgaaattgcagcgtctcaaggt
cgtggttttgacaaagacaaagagaacgacactcaagaagcgcatgagcttaacgaagagttggacattcgtgagagcga
aaaaggtaaagtctctgacttaatcctaccgattgttacgcttatcatcgcgacaattgcttcgatgatgtacaccggtg
gtcaagcgttggctgctgacggtaaagagtttgcattgttaggtgcattcgagaataccgatgtgggtacgtctctgatt
tacggtagcttgcttggtttggccgttgctctgtttactgttctaaaacaaggtctaccactgactgagattactcgtac
actgtggattggtgctaaatcgatgtttggtgcgattcttatccttgtgtttgcgtggacaatcggttctgttatcggtg
acatgaagacgggttcgtacctatcgactatggctcaaggtaacattaatccgcattggttacctgtaatcctgttcttg
ttgtcgggtctaatggcgttctcaaccggtacttcatggggtacattcggtatcatgttaccaatcgccggtgatatggc
gggtgcaactgacatcgcactaatgcttcctatgctaagtgcagttttggccggtgcagtattcggtgaccactgttcac
caatctcggacacgactattttgtcttcgacaggtgctcgttgtaatcacatcgaccacgtatcgactcagttgccttat
gcgctgtcagttgctttggtttcatgtgtcggctttattgcacttggtatgacaacgtcaatcgcgttctctttcattgc
agcatcgattacatttgttatcgtctgtgctgttctatcatggttgtcgaaatcgaaaatagaatcatgtcagagcgctt
aa

>>MEG_6978|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET35
ATGTGTGTGATCATGCCAGCTTCTAGTTGGGGTGCGTACATCATTACCATCATCGGTGGTATCTTGGTGTCACACGGCAT
CACTGAATACTCGGCGCTTGGTGCTTACGTTCGTCTTATTCCTATGAACTTCTACGCAGTATTTGCTCTACTAATGGTAT
TTGCAGTGGCGTGGTTTGGTCTAGATATCGGTAAGATGCGTGAACATGAAATCGCAGCATCTCAAGGCCGTGGTTTTGAT
AAAGATAAAGAGAACGACTCACAAGAAGCACACGACCTAAACGAAGAGCTAGATATTCGTGAAAGCGAGAAGGGTAAGGT
TTCTGACCTAATTCTTCCTATCGTAACGCTTATTGTGGCGACTATTGCTTCAATGCTTTACACCGGTGGTCAAGCGCTAG
CAGCAGATGGTAAAGAATTTGTGCTGTTGGGTGCGTTTGAAAACACGGATGTTGGTACTTCTCTAATCTACGGTAGTTTA
CTTGGTCTAGCAGTTGCATTGTTCACTGTTATTAAGCAAGGTCTACCAATGGTTGAGATTGCACGCACGCTTTGGATTGG
TGCTAAGTCAATGTTTGGTGCAATCCTTATCCTTGTTTTCGCTTGGACTATTGGTTCAGTTATCGGTGACATGAAGACGG
GTTCTTACCTATCTACAATGGCGCAAGGCAACATCAACCCACACTGGCTACCAGTTATCCTGTTCTTGCTGTCTGGCCTA
ATGGCGTTCTCTACAGGTACGTCATGGGGTACGTTCGGTATCATGCTTCCAATCGCGGGTGACATGGCTGGCGCAACAGA
CGTGGCACTAATGCTACCAATGCTAAGTGCGGTTCTAGCTGGTGCAGTATTTGGTGACCACTGTTCACCAATTTCAGATA
CAACGATTCTGTCGTCAACAGGTGCACGCTGTAACCACATCGATCACGTATCGACGCAGCTACCTTATGCATTATCAGTG
GCGTTTGTGTCATGTATTGGCTTTATCACGCTGGGTATGACTGCATCGATCGCGTTCTCTTTCATCGCAGCATCGATCAC
TTTCGTTATCGTTTGTGCGATTCTGTCGTGGCTGTCGAAGTCTAAAATGGCATCCTGCCAGAACGCGTAG