MEGAResFrom MEG, the Microbial Ecology Group

TET33

The tet33 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6972|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET33
gtgtcatttctcacttccgctcgtggctcgttggccacggtcctcatcacggctagcctcgacgccgccggcatgggcct
ggtgatgccgattcttcccgcactgctacacgaggcaggggtcaccgctgatgcggttccgctgaacgtcggagtgctga
tcgcgctctacgcggtaatgcagttcatctttgcccccgtactgggaacgctgtcggaccgattcggccgccgccgggtg
ctgcttgtttccctggccggtgcgaccgtggactatctcgtgctcgccacgacgtccgctctgtcggtgttctatatcgc
ccgcgcagtggctgggataaccggagcgaccaatgcggtcaccgccaccgtgatcgccgacatcacgccaccccaccagc
gcgccaagcgtttcggtttactcagtgcctgctatggcggcggaatgatcgcggggccagccatgggtggactgttcggt
gccatctcgccacatctgccgtttttgctcgctgctcttctctcagcgagcaatctggcactcacctttatcctgttacg
cgagacccgtcctgattcccctgcgcgctctgcgtcgctcgctcagcatcgtggtcgccccggcctcagcgcggtgcctg
ggattaccttcctattagtcgcattcggccttgttcaattcattgggcaggctccaggtgcgacctgggtgctgtttact
gaacaccgcctcgactggagtcccgtcgaagttggaatctccctgtccgttttcgggatcgtacaggttctcgtgcaggc
cctccttactggccgcatcgtggagtggatcggtgaggcaaaaacagtcatcatcgggtgtgttaccgacgccttgggtc
tcgtaggcctggcgattgtcactgacgcattttccatggcgcctatcttggcggcactcgggatcggtggcatcggcctc
cccgctctgcaaacccttctctcccagcgcgtcgatgaacagcaccaagggcgcctccagggtgtgctcgccaggatcaa
cagcatcacatcgatcttcggaccggtcgctttcacaacgatcttcgcgctcacttacatcaacgccgacggcttcctct
ggctctgcgccgcagcactctacgtgccctgcgtgattctcatcatgcgtggtacagcagcgtccccgaagttcggctct
tgggcgagcggcgactcgatgtga

>>MEG_6973|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET33
GTGTCATCTCTCACTTCCGCTCGTGGCTCGTTGGCCACGGTCCTCATCACGGCTAGCCTCGACGCCGCCGGCATGGGCCT
GGTGATGCCGATTCTTCCCGCACTGCTACACGAGGCAGGGGTCACCGCTGATGCGGTTCCGCTGAACGTCGGAGTGCTGA
TCGCGCTCTACGCGGTAATGCAGTTCATCTTTGCCCCCGTACTGGGAACGCTGTCGGACCGATTCGGCCGCCGCCGGGTG
CTGCTTGTTTCCCTGGCCGGTGCGACCGTCGACTATCTCGTGCTCGCCACGACGTCCGCTCTGTCGGTGTTCTATATCGC
CCGCGCAGTGGCTGGGATAACCGGAGCGACCAATGCGGTCACCGCCACCGTGATCGCCGACATCACGCCACCCCACCAGC
GCGCCAAGCGTTTCGGTTTACTCAGTGCCTGCTATGGCGGCGGAATGATCGCGGGGCCAGCCATGGGTGGACTGTTCGGT
GCCATCTCGCCACATCTGCCGTTTTTGCTCGCTGCTCTTCTCTCAGCGAGCAATCTGGCACTCACCTTTATCCTGTTACG
CGAGACCCGTCCTGATTCCCCTGCGCGCTCTGCGTCGCTCGCTCAGCATCGTGGTCGCCCCGGCCTCAGCGCGGTGCCTG
GGATTACCTTCCTATTAATCGCATTCGGCCTTGTTCAATTCATTGGGCAGGCTCCAGGTGCGACCTGGGTGCTGTTTACT
GAACACCGCCTCGACTGGAGTCCCGTCGAAGTTGGAATCTCCCTGTCCGTTTTCGGGATCGTACAGGTTCTCGTGCAGGC
CCTCCTTACTGGCCGCATCGTGGAGTGGATCGGTGAGGCAAAAACAGTCATCATCGGGTGTATTACCGACGCCTTGGGTC
TCGTAGGCCTGGCGATTGTCACTGACGCATTTTCCATGGCACCTATCTTGGCGGCACTGGGGATCGGTGGCATCGGCCTC
CCCGCTCTGCAAACCCTTCTCTCCCAGCGCGTCGATGAACAGCACCAAGGGCGCCTCCAGGGTGTGCTCGCCAGCATCAA
CAGCGTCACATCGATCTTCGGACCGGTCGCTTTCACAACGATCTTCGCGCTCACTTACATCAACGCCGACGGCTTCCTCT
GGCTCTGCGCCGCAGCACTCTACGTGCCCTGCGTGATTCTCATCATGCGTGGTACAGCAGCGTCCCCGAAGTTCGGCTCT
TGGGCGAGCGGCGACTCGATGTGA

>>MEG_6974|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET33
CTGATCGCGCTCTACGCGGTAATGCAGTTCATCTTTGCCCCCGTACTGGGAACACTGTCGGACCGATTCGGCCGCCGCCG
GGTGCTGCTTGTTTCCCTGGCCGGTGCGACCGTCGACTATCTCGTGCTCGCCACGACATCCGCTCTGTCGGTGTTCTATA
TCGCCCGTGCAGTGGCTGGGATAACCGGAGCGACCAATGCGGTCACCGCCACCGTGATCGCCGACATCACGCCACCCCAC
CAGCGCGCCAAGCGTTTCGGTTTACTCAGTGCCTGCTATGGCGGCGGAATGATCGCGGGGCCAGCCATGGGTGGACTGTT
CGGTGCCATCTCGCCACATCTGCCGTTTTTGCTCGCTGCTCTTCTCTCAGCGAGCAATCTGGCACTCACCTTTATCCTGT
TACGCGAGACCCGTCCTGATTCCCCTGCGCGCTCTGCGTCGCTCGCTCAGCATCGTGGTCGCCCCGGCCTCAGCGCGGTG
CCTGGGATTACCTTCCTATTAATCGCATTCGGCCTTGTTCAATTCATTGGGCAGGCTCCAGGTGCGACCTGGGTGCTGTT
TACTGAACACCGCCTCGACTGGAGTCCCGTCGAAGTTGGAATCTCCCTGTCCGTTTTCGGGATCGTACAGGTTCTCGTGC
AGGCCCTCCTTACTGGCCGCATCGTGGAGTGGATCGGTGAGGCAAAAACAGTCATCATCGGGTGTATTACCGACGCCTTG
GGTCTCGTAGGCCTGGCG

>>MEG_6975|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TET33
TCACATCGAGTCGCCGCTCGCCCAAGAGCCGAACTTCGGGGACGCTGCTGTACCACGCATGATGAGAATCACGCAGGGCA
CGTAGAGTGCTGCGGCGCAGAGCCAGAGGAAGCCGTCGGCGTTGATGTAAGTGAGCGCGAAGATCGTTGTGAAAGCGACC
GGTCCGAAGATCGATGTGATGCTGTTGATCCTGGCGAGCACACCCTGGAGGCGCCCTTGGTGCTGTTCATCGACGCGCTG
GGAGAGAAGGGTTTGCAGAGCGGGGAGGCCGATGCCACCGATCCCGAGTGCCGCCAAGATAGGCGCCATGGAAAATGCGT
CAGTGACAATCGCCAGGCCTACGAGACCCAAGGCGTCGGTAACACACCCGATGATGACTGTTTTTGCCTCACCGATCCAC
TCCACGATGCGGCCAGTAAGGAGGGCCTGCACGAGAACCTGTACGATCCCGAAAACGGACAGGGAGATTCCAACTTCGAC
GGGACTCCAGTCGAGGCGGTGTTCAGTAAACAGCACCCAGGTCGCACCTGGAGCCTGCCCAATGAATTGAACAAGGCCGA
ATGCGACTAATAGGAAGGTAATCCCAGGCACCGCGCTGAGGCCGGGGCGACCACGATGCTGAGCGAGCGACGCAGAGCGC
GCAGGGGAATCAGGACGGGTCTCGCGTAACAGGATAAAGGTGAGTGCCAGATTGCTCGCTGAGAGAAGAGCAGCGAGCAA
AAACGGCAGATGTGGCGAGATGGCACCGAACAGTCCACCCATGGCTGGCCCCGCGATCATTCCGCCGCCATAGCAGGCAC
TGAGTAAACCGAAACGCTTGGCGCGCTGGTGGGGTGGCGTGATGTCGGCGATCACGGTGGCGGTGACCGCATTGGTCGCT
CCGGTTATCCCAGCCACTGCGCGGGCGATATAGAACACCGACAGAGCGGACGTCGTGGCGAGCACGAGATAGTCCACGGT
CGCACCGGCCAGGGAAACAAGCAGCACCCGGCGGCGGCCGAATCGGTCCGACAGCGTTCCCAGTACGGGGGCAAAGATGA
ACTGCATTACCGCGTAGAGCGCGATCAGCACTCCGACGTTCAGCGGAACCGCATCAGCGGTGACCCCTGCCTCGTGTAGC
AGTGCGGGAAGAATCGGCATCACCAGGCCCATGCCGGCGGCGTCGAGGCTAGCCGTGATGAGGACCGTGGCCAACGAGCC
ACGAGCGGAAGTGAGAAATGACACCTTATCAACGATAAAGTTATCGATGATAAAGTGCAA