MEGAResFrom MEG, the Microbial Ecology Group

TCR3

The tcr3 gene (also known as tcrC) encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Tetracycline resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_6650|Drugs|Tetracyclines|Tetracycline_resistance_MFS_efflux_pumps|TCR3
ATGGGAATGGCGAACGCCACCTCGCAGACCGGCGAGGCCGTCGCGGACGAGGCCGGCGGCCCCGCCGGCTTCACTCACCG
CCAGATCATCACCGCGCTGTCCGGGCTCCTGTTGGCCGTGCTGCTCGCCGCACTCGACCAGACGATCGTCTCCACCGCGC
TGCGTACGATCGGCGACCAACTGCACGGCCAGACCGTCCAGGCCTGGGTGATCACCGGCTACCTGGTCAGCTCCACGATC
GCGATGCCGTTCTACGGCAAGCTGTCCGACATCTACGGCCGCAAGCCGCTCTATCTGGCGGCGATCGCGGTCTTCATCGT
CGGCTCGGCGGCCTGCGCGATGGCGAACTCGATGGAGACGCTGGCGATCGCCCGCGTCCTCCAGGGCTTCGGCGGCGCCG
GGCTGATGTCGCTGCCGACGGCCGTCATCGCCGACCTCGCCCCGGTGCGCGAGCGCGGGCGCTACTTCTCGTACCTGATG
ATGGCCTGGGTGGCGGCCAGTGTGCTCGGCCCGCTCGTCGGGGGCCTGTTCGCGGGCGCCGGCGAGATCCTCGGGGTGAC
CGGCTGGCGCTGGGCCTTCCTGATCAACGTGCCGCTCGGTCTCGTGGCGCTGCTCAGCGTGCGCAAGGCGCTCAACCTGC
CGCACCGCAGGGTGGACCACCCGATCGACTTCCGGGGGGCGCTCACCCTGGCGCTCTGCCTGGTGCCGCTGCTGATCGTG
GCGGAGGAGGGCCTCGACTGGGGCTGGGGATCGGCGCGTTCGCTGACGCTGTTCGCCGTCTCGCTGATCGGCCTGGTGCT
GTTCGTGCTCGCCGAGCGGGCCCGCGGGCTGGAGGCGATGGTCCCGCTGCGGCTGTTCCGGCGCGGTGGCATCACGATGG
CCACGGCCGTCAACTTCACCATCGGCGTCGGCATCTTCGGTACGGTCTCCACCCTGCCGCTGTTCCTGCAGCTGGTGCAG
GGGCGCAGTGCCACCGTCGCCGGACTGGTGATCATCCCGGTGATGACCGGGGCGATCGTCTCCCAGACGATCTGCGCCAA
GATCATCAAGAAGTGGAACCGCTACAAGAAGCCCGCGATCGTGGGCCTCGGCTCGATGGCCGGAGCACTGCTGTCGCTCT
CCGCCGCGGGCGCGGACACCCCGCTCGCGGTGATCGTGGTGATCGCGGCCTGGCTGGGCTTCGGCATCGGGCTCTCCCAG
ACCGTCATCACCCTGGCGATCCAGAGCTCGGCGCCCAAGTCCGAGCTGGGCGTGGCCAACGCCGCCTCCGGGCTGTTCCG
CCAGCTCGGCGGCACGAGCGGCGCCGCCGTCTTCATGTCGGTGCTGTTCGGCGTCGCCGCCGGCAGGCTCGACGGGGCCG
ACCCGGACGAGGCCGTGCGCCGTGCGCTCTCCGACCCGGGCTCCACCGGCGGCCTGAGCGCCTCGGCGGTCGACGCCTTC
ACCTCGGGCTTCGACACGATGTTCCTGGTCGGCGGCCTGATCCTTGCGGTGGGCTTCCTGCTCACCTTCCCGCTGCGGGA
ACTGCGCGACGAGGAGTGA