MEGAResFrom MEG, the Microbial Ecology Group

FOLP

The folP gene encodes the wild-type dihydropteroate synthase. Mutations in this gene can cause reduced preference for the sulfonamide analogue for PABA, leading to resistance.

References

Other Groups in Sulfonamide-resistant dihydropteroate synthases

Sequences

Download Sequences

>Sul|NC_007793.3915320|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>Sul|CP000675.2|gene3019|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGAATTCTGAACAGTTCCTCGGTTGGCTTGAGCGAAAGAGCCAACCTGCTTCTTCCTTGGTTTTTGAAAAGCCGTTAAT
TATGGGTGTGCTAAATGTTACCTCTGATTCATTTTATGATGGTGGCAAGTATCTGTCTGTGGATAGAGCTTATGAGCAAG
CCATACAATTAATTGCATGTGGAGCTGATCTCATTGATATTGGTGGGGAATCAACCAAACCCGGTGCTCCGCCAGTCCCT
TTAGATGTTGAACTATCAAGAGTTCTTCCCATAATCAAACAACTTCGTGCGTTCACAGATGTGTGTATTTCTATTGATAC
AAATAAGCCAGAAGTGATGGAAGCGGCAATTAATGCTGGTGCGCATGTTATAAATGATGTTTATGCTTTAAGAAGGGATG
GTGCTCTGAATGTTGCTGCACAATTAGATGTTCCTGTCTGTTTAATGCACATGAAAGGAGAGCCGCGAACCATGCAAGAA
AATCCTTCTTACCCAGAAGGGATAATGAAGGAATTACAGCATTTTTTTGAAGAACGCATCGATAAATGCCAGAAAGCCGG
GCTGAATAGGAATAAATTAATTCTTGACCCTGGCTTTGGTTTTGGAAAGCGCGTTCAAGATAACCTACAATTAATTTATC
ATCTGAACGAATTGCATTCTTTTGGATTGCCAATTCTTTTGGGCGTTTCACGCAAAAGCACAATTGGTGCCGTGTTGAAT
ACTGAGGTTGAACAACGTTTGATTGGAAGTATTACGCTAGGGATATATGCGGCTCTTAAAGGCACTGCAATTATCAGGAC
ACATGATGTAGATGAAACGAATCAAGCATTAACTATGATTAATGCAATTTATCAAGCTGCTAAAGAAATCAGTTAA

>Sul|CP004022.1|gene3451|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAATTAATTGCCAGAGGAAGAGAGCTTAATTTATCTTCACCCCAAGTGATGGGCATTTTAAATGTGACGCCAGATTC
ATTTTCTGATGGCGGAACGCATAACTCTCTTAATGATGCTATTAACCACGCCGCTAAACTTATTGCTGAAGGGGCTTCTA
TCATCGATATCGGTGGTGAATCAACAAGGCCGGGTGCCAGTGATGTTTCTGTCGATGAAGAATTACATCGTGTTATTCCT
GTGGTCGAAGCTATCCAGCAACGTTTTGATGTGTGGATTTCTGTTGATACATCCAAAGCACAAGTGATCACGGAGTCCGC
TCAAGCTGGTGCCTCTATTATCAATGATATACGTTCACTTACCGAACCTGGAGCACTGCAGGCGGCTGCAAAAACGGGGT
TACCTGTTTGTATTATGCATATGCAAGGTTTACCTAAAACAATGCAACATTCGCCGCAGTATAAGAATGTGATGATAGAA
GTTGATGCTTTTCTAGCAGAGAATATTCAACGTTGTATTGATGCTGGCATCGAGAAAAATCAAATTATTCTTGATCCAGG
CTTCGGCTTTGGTAAAAATTTAGCGCATAATTATCAATTATTAGCACATCTAAGTGATTTTCATCACTTTGGTTTACCGA
TACTCGCCGGAATGTCACGTAAATCAATGGTAGGACAGTTACTCAATGTTCCGCCACAAGAGCGTGTTGCTGGTAGTGTT
GCTTGCGCAGTTATTGCTGCAATGCAAGGGGCACAAATTATTCGTGTACACGATGTTAAAGAGACTGTAGATGCGATGAA
AGTCGTGCAGGCGACTCTTTCTGCAAAGGAAAATAATGAATGA

>Sul|CP001581.1|gene938|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGATTATAGAATTAAATAAAAATAGTTTCCCAGAAGAGTTCAATAAGATAGAAGTACATGAGGGTAGTGTGAATATATT
TATGAATAAAAATAGTATTACCCCTTTAAAAATTTTTAATGTGCTAGCTCCTGCGGCCAATATAATAAAGCAAGAAATAC
TGGCTTTAGGTGGAGATTGTGCTGTAAATAAATATTGTATAAATTGCAAAGTGGAAACTTCAGATATAATTTTATTAGGA
ACCAAAAGACAGTACAAAAAATTATTGCAAAAGCTTAAATGCATGACTTTTTTTAGAATAGAAGAAATAGTAGGGGAATT
AGAAAATTATATTAACAATCATAAAAAAATTAAAACGGTTTTAAGAGATGGAAGAGAAATAAACTATGAGAATTTAAAGG
TTATGGGAATTATAAATTGTACTCCAGATTCTTTTTATGAGGGCTCTAGAAAAAATTCTATAGAAGAAGCTTTAAAAACT
GCAGAAAAGATGTTAAAAGAAGGGGCAGAAATTTTAGATATAGGTGGAGAATCCACAAGACCAGGTTCTGACCCAGTAGA
TGAAGAGGAAGAAATAAAAAGAGTAGTTCCTGTTATAAGAGAGATAAAGAATAAATTTAAGGATGTCATAATTTCCATAG
ATACTTATAGAGCAAATACGGCAAAGGCTGCCATAGAGGCAGGTGCAGACATAGTAAATGATATAAGTGCTATGAAGTAT
GATGAAAATATGGTGAAAGTAGTTAAAGAATACAATATACCTGTAATACTTATGCATGTAAAAGGAAAACCAAAGGATAT
GCAAATAGATCCAGTTTATGAGAATTTAATGAAAGAAATTCATCTTTATTTTAATGAGAGAATAGAGTACTGCAAATCTC
ATGGCATAACAGAGGATAAAATAATATTAGATCCAGGCATAGGTTTTGGAAAAACTGTAGAGCATAATCTAAAAATAATG
AACAGATTAGAAGAATTGAAAAGCTTTAATCTTCCAGTACTTTTAGCAGCCTCAAGAAAAGCCACAATAGGAAAAGTTTT
AGGAAACTTATCTACAGAAGAAAGATTAGAAGGAACTATAGCTTTATCCTGTTTAGCTGTAAATTCAGGACTTCAAATGG
TGAGAGTACACGATGTTAAAGAAAATGTAAGAGCCATAAGAATGTTAGAGGCAGTAAGAAAAATATAA

>Sul|AE000516.2|gene3902|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGGGGTTCTAAACGTCACGGACGACTCTTTCTCGGACGGCGGGTGTTATCTCGATCTCGACGATGCGGTGAAGCACGG
TCTGGCGATGGCAGCCGCAGGTGCGGGCATCGTCGACGTCGGTGGTGAGTCGAGCCGGCCCGGTGCCACTCGGGTTGACC
CGGCGGTGGAGACGTCTCGTGTCATACCCGTCGTCAAAGAGCTTGCAGCACAAGGCATCACCGTCAGCATCGATACCATG
CGCGCGGATGTCGCTCGGGCGGCGTTGCAGAACGGTGCCCAGATGGTCAACGACGTGTCGGGTGGGCGGGCCGATCCGGC
GATGGGGCCGCTGTTGGCCGAGGCCGATGTGCCGTGGGTGTTGATGCACTGGCGGGCGGTATCGGCCGATACCCCGCATG
TGCCTGTGCGCTACGGCAACGTGGTGGCCGAGGTCCGTGCCGACCTGCTGGCCAGCGTCGCCGACGCGGTGGCCGCAGGC
GTCGACCCGGCAAGGCTGGTGCTCGATCCCGGGCTTGGATTCGCCAAGACGGCGCAACATAATTGGGCGATCTTGCATGC
CCTTCCGGAACTGGTCGCGACCGGAATCCCAGTGCTGGTGGGTGCTTCGCGCAAGCGCTTCCTCGGTGCGTTGTTGGCCG
GGCCCGACGGCGTGATGCGGCCAACCGATGGGCGTGACACCGCGACGGCGGTGATTTCCGCGCTGGCCGCACTGCACGGG
GCCTGGGGTGTGCGGGTGCATGATGTGCGGGCCTCGGTCGATGCCATCAAGGTGGTCGAAGCGTGGATGGGAGCGGAAAG
GATAGAACGCGATGGCTGA

>Sul|NC_011586.7045208|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGC
TGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGA
GGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCA
ATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCC
TGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCG
CCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTG
CGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATC
GCCGCCCGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCT
TCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAAT
GGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCG
CAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAG

>Sul|NC_011586.7045179|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGGAAGTCGCCAATGTGCCACGGCGTCATTGCTGCCTTTTTGCTCGCCCGATCCCCATCGTGGAAGTCGCTGCGGAGGC
CGACGCCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCG
CCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCG
GACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCG
TGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAG
GATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGAT
GGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTC
CGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGG
AAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGG
AAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGAT
CGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGA
AATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAG

>Sul|NC_003197.1.1254818|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTCGCTCAGGGCGCCACGCTCGATCTCACTCATCCGCATGTTATGGGGATCCTGAACGTAACGCCGGATTC
GTTCTCCGACGGCGGCGCGCATAACACGCTGATTGAGGCGGTGAAACATGCGAATTTAATGGTGAATGCCGGGGCGACAA
TTATTGATGTGGGGGGGGAATCAACGCGACCAGGCGCGGCAGAAGTGAGCGTGGAAGAAGAGCTGGATCGCGTTATTCCG
GTACTGGAAGCAATCGCGCAACGTTTTGAAGTGTGGATTTCTGTGGATACCTCTAAACCCGAGGTGATCCGTGAAGCGGC
AAGGGCGGGCGCGCATATTATCAATGATGTCCGTTCACTCTCCGAACCCGGCGCGTTGGAAGCGGCAGCGGAAACCGGCT
TGCCGGTCAGTCTTATGCACATGCAGGGCAACCCCAAAACCATGCAGGAGGCGCCGAAATATGACGATGTCTTTGCCGAG
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGTGAGAAGGCCGGCATCGCAAAAGAGAAATTGTTGCTCGACCCAGG
ATTCGGTTTCGGTAAAAATCTCTCTCACAATTATACCTTACTGGCGCGACTGGGTGAGTTTCATCATTTTAACCTGCCGC
TGCTGGTGGGCATGTCACGTAAAACGATGGTTGGTCAGTTACTTAACGTGGGACCATCAGACCGTCTGAACGGCAGCCTT
GCGTGCGCGGTAATTGCCGCGATGCAGGGCGCGCAGATCATTCGCGTCCATGACGTCAAAGAAACCGTAGAGGCGATGCG
GGTGGTGGAAGCCACTCTGTCTGCAAAGGGAAACAAACGCTATGAGTAA

>Sul|AM180355.1|gene1650|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGTCATTAATTGTGTTTGATTATGGTAAAAGAACTTATATAATGGGAATATTAAATGTAACTCCAGATAGTTTTTCTGA
TGGAGGAGATTTTAATAACTTGGACATAGCAATACAACATGCAAAAGATATGGTTGACCAAGGTGCAGATATAATAGACC
TAGGAGGAGAGTCTACACGCCCAGGTCATAGCTATGTAGACTCAGACGAAGAGCTAAGAAGAGTAATCCCTGTAATAAAA
AAACTTAAACAGGAATTGGATATACCAATATCAATAGACACTTATAAGGCAGATGTTGCAGAAGAAGCATTAAAATTAGG
TGTCACTATGGTAAATGATGTTTGGGGTCTTAGAAAAGATAAAAATATGGCTTCTGTAATAGGAAAATATGATGCAGAAG
TGTGTATAATGCATAATCAAGATGGGACAAACTATGACAAAGATATAATGGAGTCAATAAAAGACTTTTTTAAGGTAAGT
ATAGAAATGGCAATGAGTTGTGGTGTAAAAAAAGAAAAAATAGTACTTGACCCAGGTGTAGGATTTGGCAAGGATTTTGA
ACAAAATATTGAAGTATTGAGAAGATTAAATGAATTAAAAGATTTAGGGTATCCTATTTTGCTTGGGACATCCAGAAAAT
CAGTAATAGGAAAAGTACTTCCAGTTGAGCCTAAAAAAAGATTAGAAGGTACAATAGCTACTACTGTTCTTGGTATAAGA
GATGGCGTAGATATAGTTAGAGTACATGATGTTTATGAAAATTTAATGGCAGCTAGAATGACTGATGCAATATATAGAAA
GTAG

>Sul|AL009126.3|gene92|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGCGCAGCACACAATAGATCAAACACAAGTAATCCACACTAAGCCCAGCGCTTTATCATATAAAGAGAAGACGCTGGT
GATGGGAATTTTAAACGTAACGCCTGACTCTTTCTCGGACGGCGGAAAATATGACAGCTTGGACAAGGCGCTGCTGCACG
CGAAAGAGATGATCGATGATGGTGCCCATATCATTGATATTGGAGGGGAATCGACAAGGCCTGGCGCTGAGTGCGTATCT
GAGGATGAGGAGATGTCCAGAGTCATTCCGGTGATTGAGCGGATTACGAAAGAGCTTGGTGTTCCTATTTCTGTAGACAC
GTACAAGGCTTCTGTCGCAGATGAAGCAGTGAAAGCCGGTGCATCCATTATCAATGATATTTGGGGAGCCAAACATGATC
CGAAGATGGCTTCCGTTGCAGCTGAACATAATGTTCCAATTGTACTCATGCATAACCGCCCTGAAAGAAACTACAATGAC
TTATTGCCGGATATGCTGTCGGACTTAATGGAGAGTGTAAAAATTGCTGTTGAGGCCGGAGTAGACGAGAAGAACATTAT
TCTTGATCCTGGTATCGGTTTCGCGAAAACCTATCACGATAACTTGGCAGTGATGAACAAACTAGAGATTTTCAGCGGAT
TGGGATATCCGGTTCTTCTGGCAACCTCCCGAAAAAGATTCATCGGACGTGTTCTGGATCTTCCGCCTGAGGAGCGGGCT
GAGGGCACAGGCGCGACTGTGTGTCTCGGCATTCAAAAAGGCTGTGACATTGTCAGGGTCCATGATGTAAAGCAAATTGC
CAGAATGGCGAAAATGATGGACGCGATGCTGAATAAGGGAGGGGTGCACCATGGATAA

>CARD|pvgb|AL450380|296695-297550|ARO:3003389|Mycobacterium|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGAGTTTGGCGCCAGTGCAGGTTATTGGGGTTTTGAACGTCACTGACAATTCGTTCTCAGATGGCGGACGTTACCTTGA
TCCTGACGATGCTGTCCAGCACGGCCTGGCAATGGTCGCGGAAGGCGCGGCGATTGTCGACGTCGGTGGCGAATCGACCC
GGCCCGGTGCCATTAGGACCGATCCTCGAGTTGAACTCTCTCGTATCGTTCCTGTCGTAAAAGAACTTGCAGCACAGGGG
ATTACAGTAAGTATCGATACTACGCGCGCTGATGTTGCACGGGCGGCGCTGCAAAGCGGCGCACGGATCGTCAACGATGT
GTCTGGTGGGCGAGCAGATCCCGCGATGGCTCCTCTGGTGGCTGAAGCCGGTGTTGCGTGGGTGTTGATGCACTGGCGAC
TGATGTCGGCTGAACGGCCGTATGAGGCTCCGAATTACCGCGACGTGGTGGCTGAAGTGCGTGCCGACCTACTGGCTGGT
GTCGATCAGGCTGTGGCCGCAGGTGTTGATCCTGGGAGTCTAGTGATCGATCCCGGGCTTGGATTCGCCAAGACGGGACA
GCACAATTGGGCGCTGCTGAATGCGTTACCGGAGTTGGTGGCTACTGGGGTCCCGATTCTACTTGGCGCCTCGCGTAAAC
GGTTCCTGGGTAGGTTATTAGCTGGGGCTGATGGCGCGGTACGACCGCCGGACGGACGTGAGACGGCGACCGCGGTGATT
TCCGCACTTGCTGCCCTACACGGGGCTTGGGGTGTTCGGGTGCACGATGTGCGTGCCTCGGTCGACGCACTCAAGGTCGT
CGGGGCTTGGCTGCATGCTGGGCCGCAGATTGAAAAGGTTAGATGTGATGGCTGAC

>Sul|CP000768.1|gene1044|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAATTTTTTAAAATCAATCCAAACACCGATTTTAACTTGCTTTGTTCTCTTATAAACCCTCATAAAATGGGGCAAAA
GATTATGAGTGAGAAAACAAAAACTCATTATATTTTTATCAAAGATATTTCTACTCCTGCAGCAAATATTTTAAAACAAG
ATGCTTTAAGAGTAGGAGCTGAACTTATTACCCATAAAGAAGTAATTACTGCAAAAATCACTCATTCAAATGCGCTTTTA
ATGGCAAGTAAAGAACAAATTCAAAAGCTTATTGCTAAAGAAAAACTTCAAGATTTTGGACTTAAAAATTTGGCTCTTTT
TTTGCAAAAAGATTTTTTAAAACCAAAAAAAGCCGAGCTTATGGCAGTGATTAACGTCAATGAAGACAGTTTTAATGCAA
AAAGTCGTGTGAGTGAAAAAGACTTTGAAAAAAGGCTTAATGATTTTCTTGCTTTAAAGCCTGAGTATATCGATATAGGT
GCAGTAAGTTCAAGACCTGGGAGTGAGTATTGTGGTAAGGAAGAAGAATTTAAAAGACTCAAAAAAATACTTGACTTAAT
TCATGAGAAAAATTATCACGAAAAAGCGATTTTTAGTTTAGATAGTTTTGATGAGTATTGTCTAGAATATGCCTTAAATA
AGGGTTTTAAACTCATTAATGATATTACAAGTTTAAGAAATCTTAATCTAGCTAAACTTGCAAGTAAATATGAGGCAAAA
TATTGCTTAATGCACATGCAAAACAATCCAAATAACATGCAAGATAATCCTTTTTATGAAGATTTACTTGATGAGATGAC
TTTGTTTTTTAAAGAAAAACTTGAACTTTTAGAAAGTTTTGGAGTAAAAGAAAGTATTTTAGATGTAGGTATTGGCTTTG
GAAAGAGTGCGGAGCATAATATGATTTTAATCAAACATTTGGAGCATTTTTTGCAATTTAATAAACCTTTGCTTATAGGT
GCGAGTCGCAAAAGTGTGATTAATGCATATTTTCAAAGCGAGATTAAAGATCGTTTGGCAGGGACTTTGTATTTGCATTT
AAAGGCTTTTGAAAATGGTGCTAGTATTATAAGAGTGCATGATTTATATGAGCACAAACAACTTTTTGCTTTAGTACAGG
CAATGGATAATATAGGAGTTTAG

>Sul|NC_002695.1.916103|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTTGCCCAGGGTACTTCACTGGACCTTAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTC
CTTTTCGGATGGTGGCACGCATAACTCGCTGATAGATGCGGTGAAACATGCGAATCTGATGATCAACGCTGGCGCGACGA
TCATTGACGTTGGTGGCGAGTCCACGCGGCCAGGGGCGGCGGAAGTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCT
GTGGTTGAGGCAATTGCTCAACGCTTCGAAGTCTGGATCTCGGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGC
GAAAGTTGGCGCTCACATTATTAACGATATCCGCTCCCTTTCCGAACCTGGCGCTCTGGAGGCGGCTGCAGAAACCGGTT
TACCGGTTTGTCTGATGCATATGCAGGGAAATCCAAAAACCATGCAGGAAGCCCCGAAGTATGACGATGTCTTTGCAGAA
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGCGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGG
ATTCGGTTTCGGTAAAAATCTCTCCCATAACTATTCATTACTGGCGCGCCTGGCTGAATTTCACCATTTCAACCTGCCGC
TGTTGGTGGGTATGTCACGAAAATCGATGATTGGGCAGCTGCTGAACGTGGGGCCGTCCGAGCGCCTGAGCGGTAGTCTG
GCCTGTGCGGTCATTGCCGCAATGCAAGGCGCGCACATTATTCGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCG
AGTGGTGGAAGCTACTCTGTCTGCAAAGGAAAACAAACGCTATGAGTAA

>Sul|NC_002951.3237126|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAATGAGACCCG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAAAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>Sul|NC_003923.1002573|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCAG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>Sul|NC_009641.5330254|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTATCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GTCATGAAATGGTTTCATTAGAAGAAGAGATGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAAAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>CARD|pvgb|NC_007779|3323917-3324766|ARO:3003386|Escherichia|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
TTACTCATAGCGTTTGTTTTCCTTTGCAGACAGAGTGGCTTCCACCACCCGCATCGCTTCTACGGTTTCTTTGACGTCAT
GAACACGAATGATGTGCGCGCCTTGCATTGCGGCAATGACCGCACAGGCCAGACTACCGCTCAGGCGCTCGGACGGCCCC
ACGTTCAGCAGCTGCCCAATCATCGATTTTCGTGACATACCCACCAACAGCGGCAGGTTGAAATGGTGAAATTCAGCCAG
GCGCGCCAGTAATGAATAGTTATGGGAGAGATTTTTACCGAAACCGAATCCGGGGTCGAGCAACAATTTCTCTTTTGCGA
TACCCGCCTGCTCGCAACGTGCTATTTGCTCAATAAAGTAGCGATTCACTTCTGCAAAGACATCGTCATACTTCGGAGCT
TCCTGCATGGTTTTTGGATTTCCCTGCATATGCATCAGACAAACCGGTAAACCGGTTTCTGCAGCCGCCTCCAGAGCGCC
AGGTTCGGAAAGGGAGCGGATATCATTAATAATGTGAGCGCCAACTTTCGCTGACTCACGGATGACTTCTGGTTTGGATG
TATCGACTGAGATCCAGACTTCGAAGCGTTGAGCAATTGCCTCAACCACAGGAATAACACGTTGCAACTCTTCTTCAACG
CTAACTTCCGCCGCCCCTGGGCGCGTGGACTCGCCACCAACGTCAATGATCGTCGCGCCAGCGTTGATCATCAGATTCGC
ATGTTTCACCGCATCTATCAGCGAGTTATGCGTGCCACCATCCGAAAAGGAATCAGGCGTGACGTTGAGGATCCCCATTA
CGTGAGGATGGCTAAGGTCCAGTGAAGTACCCTGGGCAAAGAGTTTCATG

>Sul|NC_002516.2.881715|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAGCAATCCGCAATACCCGACCCGACTGCCTTGCGGCAGTCGGGTTCTTGATTTGGCCCGCCCACATGTCATGGGCAT
CCTCAATGTCACCCCCGATTCCTTTTCCGACGGCGGCCGTTACGACCGGCTGGACGATGCCCTGCGGCATGCCGAGCGCA
TGGTGCTGGAAGGCGCAACGCTCATCGACGTCGGCGGCGAGTCGACCCGTCCCGGTGCGCGCAGCGTTTCTCCGACGGAG
GAGCTGGAGCGGGTCGCTCCGGTAGTCGAACGCATCGCCCGCGAACTGGACGTCGTGATTTCGGTGGATACCTCCACGCC
TGCGGTCATGCGCGAAACTGCGCGTCTCGGAGCGGGTCTGATCAACGACGTCCGTTCGCTGCAGCGCGACGGTGCGTTGG
ATGCTGCGGTGGATAGCGGCCTGGCGGTCTGCCTCATGCACATGCGTGGAGAACCGCAGACCATGCAGGATGCGCCTGCC
TACCAGGATGTGGTGGCGGAAGTCGGCGCGTTCCTGCAGGAGCGTGTGGATGCCTGCGTGGCGGCCGGAATCGACCGCGA
GCGGCTGTTGCTGGATCCGGGTTTCGGTTTTGCCAAGACACTGGAGCACAACCTGGTGCTGTTCAGGCATCTGCAGGCGC
TCCATGGTCTGGGCCTGCCGTTGTTGGTCGGCGTTTCGCGCAAGAGCATGATCGGCAAGGTACTGGGGCGGGAGGTGGAC
GAACGCCTCTACGGCAGTCTCGCGCTGGCGGCCCTGGCGCTGGCCAAGGGCGCACGGATAATTCGAGTGCATGACGTGGC
GGCGACCGTCGACGTGATGCGAATGATCTCCGCCGTTGAAATGGCGGATTGA

>Sul|NC_012469.1.7686560|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGTGAAAAGCCTTGAGGGAGTGACCGATATGTTAAGTAAAGCCAATCGTGCAAAGACAGCTATTTGCGGAATTATCAA
TGTAACCCCAGACTCCTTTTCGGACGGTGGTCAATTTTTTGCTCTTGAGCAGGCACTCCAGCAGGCTCGTAAATTGATAG
CAGAAGGGGCTAGCATGCTAGATATCGGTGGAGAATCAACTCGGCCGGGAAGTAGCTATTATGTTGAGATAGAAGAGGAG
ATCCAGCGTGTTGTTCCAGTGATTAAAGCGATTCGCAAGGAAAGTGATGTCCTCATTTCTATTGATACTTGGAAAAGTCA
GGTTGCAGAGGCTGCTTTGGCTGCTGGTGCCAATCTAGTCAATGATATCACTGGTCTCATGGGTGATGAAAAAATGGCCC
ATGTGATAGCTAAAGATGGAGCGAAAGTGGTCATTATGTTTAATCCTGTTATGGCTCGACCTCAGCATCCTAGCTCGCTC
ATATTCCCTCATTTTGGATTTAATCAAGCTTTTACAGAGGAAGAGTTAGCTGACTTTGAAACATTGCCAATCGAAGAGTT
GATGGAGACTTTCTTTGAAAGAGCACTAGCGAGAGCAAATCAAGCTGGAATTGCACAAGAAAATATCCTGTTGGATCCAG
GAATCGGCTTTGGGCTGACTAAGAAAGAAAATTTGCTTCTTTTACGAGACCTGGATAAACTACATCAGAAGGGCTATCCA
ATCTTTCTTGGAGTGTCGCGCAAGAGGTTTGTCATCAATATCCTTGAAGAAAATGGTTTTGAAGTCAATCCTGAGACAGA
ACTTGGTTTCCACAATCGGGACACAGCTTCGGCTCATGTAACCAGTATCGCTGCGAGACAGGGTGTGGAAGTGGTGCGCG
TGCATGACGTAGCTAGTCACAGGATGGCAGTTGAAATTGCCTCCGCCATTCGTCTGGCTGATGAAGCGGAAAATCTAGAT
TTAAAACAATATAAATAA

>Sul|NC_007622.3794340|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCAGTAACTAGAGTGAAAGCGATGATGGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GCCATGAAATGATTTCATTAGAAGAAGAGCTGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTGAAA
ATTTCGGTTGATACTTTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATTATTAATGATCAATGGGC
AGGCCTTTATGATCATCGCATGTTTCAAGTTGTAGCCAAATACGATTCGGAAATTGTTTTAATGCATAATGGCAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATCTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCTGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>Sul|FN543093.2|gene431|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
CTGTTTTCGTTCATTCAAGTTCATAAGGGAATGGCAATGAAACTCTTCGCTCAGGGCTCAACGCTCGAACTTTCTCATCC
GCATGTCATGGGGATCCTGAATGTCACGCCGGATTCTTTTTCCGATGGTGGCCAGCACAACACGCTGACAGAGGCGGTAA
AACACGCCAATGCGATGATTAACGCTGGTGCGACCATCATTGACGTAGGCGGAGAATCGACGCGCCCTGGCGCGGCGGAA
GTGAGTGTGGAAGAAGAGCTTTCCCGCGTGGTGCCGGTGGTGGAAGCGCTGGCGCAGCGTTTTGAGGTCTGGGTGTCGGT
CGATACGTCTAAACCAGAAGTGATCCGCGAGTCGGCGCGGGTCGGCGCGCATATCATCAACGATATTCGCTCGCTGACGG
AGCCTGGTGCGCTTGAGGCGGCGGCAGAGACCGGTTTGCCGGTGTGTCTGATGCATATGCAGGGCCAGCCGAAAACGATG
CAGCAGGCGCCGCACTATGAAGATGTTTTTGCCGACGTCACGCGTTTTTTTGAGCAACAGATCGCCCGCTGCGAAGCGGC
AGGCATTACAAAAGAAAAAATCATACTCGACCCGGGATTCGGTTTCGGTAAAAATCTGACCCACAATTACCAGCTTCTCG
CCCGGCTTTCAGAATTCCAGCGTTTCGAAATGCCTTTGCTGGTGGGAATGTCGCGTAAGTCGATGATTGGACAACTACTT
AATGTCGGGCCCGATCAGCGTCTGCCCGGAAGCCTTGCCTGCGCGGTGATGGCGGCCATGCAGGGGGCGCAGATTATTCG
GGTTCATGACGTCAAAGAAACCGTCGAAGCGATGCGCGTGGTGGAAGCAACTCTTTCAGCGAAGGATAAAAAATGTTATG
AGTAA

>Sul|AP009048.1|gene3222|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTTGCCCAGGGTACTTCACTGGACCTTAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTC
CTTTTCGGATGGTGGCACGCATAACTCGCTGATAGATGCGGTGAAACATGCGAATCTGATGATCAACGCTGGCGCGACGA
TCATTGACGTTGGTGGCGAGTCCACGCGCCCAGGGGCGGCGGAAGTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCT
GTGGTTGAGGCAATTGCTCAACGCTTCGAAGTCTGGATCTCAGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGC
GAAAGTTGGCGCTCACATTATTAATGATATCCGCTCCCTTTCCGAACCTGGCGCTCTGGAGGCGGCTGCAGAAACCGGTT
TACCGGTTTGTCTGATGCATATGCAGGGAAATCCAAAAACCATGCAGGAAGCTCCGAAGTATGACGATGTCTTTGCAGAA
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGCGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGG
ATTCGGTTTCGGTAAAAATCTCTCCCATAACTATTCATTACTGGCGCGCCTGGCTGAATTTCACCATTTCAACCTGCCGC
TGTTGGTGGGTATGTCACGAAAATCGATGATTGGGCAGCTGCTGAACGTGGGGCCGTCCGAGCGCCTGAGCGGTAGTCTG
GCCTGTGCGGTCATTGCCGCAATGCAAGGCGCGCACATCATTCGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCG
GGTGGTGGAAGCCACTCTGTCTGCAAAGGAAAACAAACGCTATGAGTAA

>Sul|AP010904.1|gene2604|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCGGCCCACCATGCGACAGATACGTTCCACTGCGCCCATAAGCGGCCCTGGCGACTCCATGGAGCAGGACATGGCCTC
GATCTGGCGGTTGGGCGGCGGGCGGACCCTGGACTGCTCCGGGGACCGCGTCATTGGCATCGTCAACGCCACGCCCGACT
CCTTCTACGACGGCGGCCGCCACGGCGACGTGGCGGCCGCCGTATCCCATGGCCTGCGTCTGGCCGGGGAAGGGGCCGAC
ATGCTCGACATCGGCGGCGAGTCCACCCGCCCCGGGGCCGCGCCTGTCACCGACGCCGAAGAAATCGACCGGGTCGTGCC
GGTCATCGCCGAGCTTGCCCGCCGACTGCCGGACATGCCCATTGCCGTGGACACCTACCGGGCCGGCTGCGCCACCGCCG
CCCTGGCCGCCGGAGCCTGCGCGGTCAACGACGTGTCGGGGCTGGCTTTCGATCCGGCGCTGCTTGAGGTCGTTGCGCAG
CGCCAGCCCGGCTACGTGCTCATGCATACCAAAGGCCGGCCTGACGTCATGCAGCGCGACCCCCGTTACGACGATGTAAT
CGGCGAAATCCTGGCCTATTTCGAACAGGGGCTCACGCGCCTGACTCGGGCCGGGCTGCCTGAGGACCATGTGGTCCTTG
ATCCCGGCATCGGTTTCGGCAAGCTCTCGGAGCACAATCTGGAAATTTTGCGCAATCTTGAACGGTTTACGGTCTTTGGC
CGGCCGGTCTATCTCGGGCTGTCCAACAAGTCGTTTTTCGGCGCGCTCCTTGGGCTGCCCGTGGGCGAGCGCACCGTGGC
CACGGCCGTGGCCTCGGCCCTGTGCGCCGGGCGCGGGGCGCGCCTGCACCGCGTCCACGACGTCGCCGCCGTCAAACAAG
CCCTGGGCCTGGCCGCCGCCCTGGCCGGCTGA

>Sul|NC_003112.2.903415|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGCACGACACGTTTGGCAGGCAGGACGGTTTGAAATCGGTTTGGACAAACCGAAAATCATGGGCATCGTGAATCTCAC
ACCCGATTCTTTTTCCGACGGCGGCGTGTATTCGCAAAACGCCCAAACAGCCTTGGCACATGCCGAACAGCTTCTAAAAG
AAGGCGCAGACATTCTCGACATCGGCGGCGAATCGACGCGGTCGGGTGCGGATTATGTTTCGCCTGAAGAAGAATGGGCG
CGGGTTGAGCCTGTTTTGGCGGAAGTGGCGGGGTGGGGCGTTCCCATCAGTTTGGACACGCGCCGCACGGTGATTATGGA
AAAAGCGTTGGCACTCGGCGGCATCGATATTATTAATGATGTGGCGGCGTTGAATGACGAGGGCGCGGTCGAATTGCTGG
CGCGTCAGGCGGACACGGGCATTTGCCTGATGCACATGCAGGGTTTGCCCAAAACCATGCAGATTAATCCGAAATATCAA
GATGTTGTCGGTGAAGTAGCGCGGTATTTGAAAGCGCGCTCAGCGGAATGTATCGCGGCAGGCATCGCACCGCAACGCAT
CATACTCGACCCCGGCTTCGGCTCCGGCTTCGGCAAACCCTTGCAACACAATATCGCGCTGATGCGGCATTTGCCCGAAT
TGATGGCGGAAACAGGTTTTCCGCTGCTCATCGGCGTATCGCGCAAAAGCACGATAGGCGAGCTGACCGGCGAGGCAAAT
GCGGCGGAACGCGTACACGGCAGCGTGGCGGCAGCGTTGGCTTCCGTAGCGCGCGGCGCGCAAATCGTGCGGGTGCATGA
TGTGAAGGCGACAGCGGATGCGTTGAAGGTGTGGGAAGCGTTGGGCATCAATCTGTAA

>Sul|NC_002163.1.904908|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAATTTTTTAAAATCAATCCAAACACCGATTTTAATTTGCTTTGTTCTTTCATAAACCCTCATAAAATGGGACAAAA
GATCATGAGTGAAAAAACAAAAATTCATTTTATTTTTATCAAAGATATTTCTACTCCTGCGGCAAATATTTTAAAACAAG
ATGCTTTAAGAGTAGGAGCTGAACTTATTACTCATAAAGAAGTAATTACTGCAAAAATCACTCATTCAAATGCGCTTTTA
ATGGCAAGTAAAGAGCAAATTCAAAAGCTTGTTGTCAAAGAAAAACTTCAAGATTTTGGACTTAAAAATTTGGCTCTTTT
TTTGCAAAAAGATTTTTTAAAACCGAAAAAAGCCGAGCTTATGGCAGTGATTAATGTCAATGAAGACAGTTTTAATGCAA
AAAGTCGTGTGAGTGAAGAAGACTTTGAAAAAAGGCTTAATGACTTTCTTGCTTTAAAGCCTGAATATATCGATATAGGT
GCGGTAAGCTCAAGACCTGGGAGTGAGTATTGTGGCAAGGAAGAGGAATTTAAAAGACTGAAAAAAGTACTTGACTTAAT
TTATGAGAAAAATTATTACGAACAAGCAATTTTTAGTTTAGATAGTTTTGATGAATATTGTCTAGAATATGCTTTAAATA
AGGGTTTTAAACTCATTAATGATATTACAAGTTTAAGAAATCTTAATCTAGCCAAACTTGCAAGTAAATATGGGGCAAAA
TATTGCTTAATGCACATGCAAAACAATCCAAATAACATGCAAGATAATCCTTTTTATGAAGATTTGCTTGATGAGATGAC
TTTGTTTTTTAAAGAAAAACTTGAGCTTTTAGAAAGTTTTGGAGTAAAAGAAAGTATTTTAGATGTAGGTATTGGTTTTG
GAAAGAGTGCGGGGCATAATATGATTTTAATCAAACACTTAGAACATTTTTTGCAATTTAATAAACCTTTACTTATAGGT
GCGAGTCGTAAAAGTGTGATTAATGCGTATTTTCAAAGCGAGATTAAAGATCGTTTAGCGGGAACTTTATATTTGCATTT
AAAGGCTTTTGAAAATGGTGCTAGTATTATAAGAGTGCATGATTTATATGAGCATAAACAACTTTTTGCTTTAGCGCAGG
CAATGGATAATATAGGAGTTTAG

>Sul|AE016830.1|gene3181|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGATTGATTTAAAAAAGAATTACCAAATTATGGGGATTGTCAACACGACCCCCGACTCTTTTTCTGATGGCGGTAGCTA
CACAACGGTCGACGTGGCCTATCAACATGCGCTTCATCTACTAGAAGCGGGGGCCGATATTTTAGACATTGGCGGCCAAT
CCACACGTCCTGGCTACGAAGAAGTTTCTCCACAAGTTGAGGCAGACCGAGTATTACCATTAATAAAAAAAATACGTGAG
ACTTCTCTAGCGCCGATTTCTGTGGACACCTACTATCCCGAAGTAGCGGAAGCCGCGATCCAAGCTGGCGCCACAATGAT
TAATGACATCAAAGGATTAGACACTCCGGGGATGGCAGAAGTCCTCGCACAATATCCTGAAGTCCAAGTTGTGATTATGC
ATTCTAGAAAACGCCAATCGCTTTCTTTAAAAGAAGAGTTGCACCAATTTTATACAGAAAAAATTGAACAATGCCAAAAA
TATGGGCTTTCCTTAGAAAAAATTTGTTTCGATCCAGGGATTGGCTTTCATAAAACTGTCGCAGAAAACCTTCAACTGTT
AAAAGATCCTAACGCCTTTCGCTACCAAGATTATCCGTTACTATACGGCGTTTCTCGCAAACGAACCATTGGCGCTTTAA
CGAACGAACCAGAACCAGCCAACCGTGATTTTGGCTCAGCCGCTGCTTCCTTGTATGCAGCACAACAAGGCGTAGAAATT
TTACGTGTTCATAATGTCCAAGGCTTAAAACAAACATTTGATGTCTGGCGAGCATTGTCGGAGAAGGAGTAA

>Sul|CP002695.1|gene1085|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGCAAATAACTTCCAGTGCGGGCGCTTTGAGTTCGATCTCGAGCGCCCGCTTGTCATGGGCATCGTCAACGTCACGCC
CGACTCGTTTTCCGATGGCGGCGAGCACGCCGATACCGACAGCGCGATCGCCCACGCGCGCCAATTGATCGACGAAGGGG
CCCATATCCTGGACCTGGGCGGCGAATCGACGCGGCCGGGCGCGCAGCCGGTCAGCGCGGCCGACGAGCTGGCGCGCATC
CTGCCGCTGATCGAAGGGCTGCGCGACTGCGGCGTGCCGTTGTCGATCGACACCTTCAAGCCCGAGGTCATGCGCGCCGT
GCTTGACGCCGGCGCCGACATGATCAACGACATCTACGGTTTCCGGCAGCCCGGCGCCATCGACGCGGTGGCGCGCTCGC
GCTGCGGCCTGTGCGTCATGCACATGAAGGGCGAGCCGCGCACCATGCAGGAGGCGCCCGAGTACGCCGACCTGATGGGC
GAAATCGGGGTCTTCCTGGGCGCGCGCGCCCAGCGGCTGCGCGCCGCGTGGGTCGACCCCCGGCGCATCGTGCTGGACCC
GGGCTTCGGGTTCGGCAAGACCATGGATCAGAATTATCAGTTGCTGCGCCGCCTGGCCAGCTTGCGCGTCTCCAGCTACC
CCCTGCTGGTGGGCGTCTCGCGCAAATCCATGATAGGCGCGGCCACCGGCAAGCCGGTGGGCGACCGCCTGGCCGGCAGC
GTTGCCGCCGCGCTGGCATGCGTGGCGCGCGGCGCCGCCATCGTGCGTGTGCACGATGTCGCCGCGACCGTGGATGCGCT
AAAAGTGTGGCAGGCGGCCGAACAAGGAGCAGTCCCTACATGA

>Sul|CP000647.1|gene3624|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTTGTAGCCCAGGGCTCAACCCTCGATCTCTCTCACCCCCACGTGATGGGTATTCTAAATGTGACGCCTGACTC
CTTCTCCGATGGCGGCGCCCATAATTCGCTGATTGAGGCGGTGAAGCATGCCAATCTGATGATCAACGCCGGCGCGACCA
TCATTGATATCGGCGGTGAATCGACGCGGCCAGGGGCGGCTGAGGTTAGTGTGGAAGAGGAGCTTGCGCGGGTGATACCG
GTGGTTGAAGCCATTGCCCAGCGCTTTGAGGTATGGATCTCAGTGGATACCTCCAAGGCGGAGGTTATTCGCCAATCGGC
CAGGGCCGGGGCGCATATCATCAACGATATTCGTTCGCTGACCGAGCCCGGCGCGCTGCAGGCCGCCGCGGAAACCGGAC
TGCCAGTGTGTCTGATGCATATGCAGGGACAACCAAAAACCATGCAGGAGGCGCCGAAGTATGAGGACGTCTTCGCCGAT
GTTGAGCGTTTTTTTAATGAGCACATTGTGCGCTGCGAACAGGCAGGGATCGCAAAAGAAAAATTGCTGCTCGACCCGGG
ATTCGGTTTCGGTAAAAATCTCTCCCACAATTACCAACTGTTGGCCAGGCTTGGGGAGTTTCATCACTTTGGTCTGCCGC
TGCTGGTCGGTATGTCACGTAAGTCGATGGTAGGTCAGTTGCTGAACGTCGGGCCGTCGGAGCGGCTGAACGGCAGCCTG
GCGTGTGCCGTCATTGCAGCAATGCAGGGCGCGCAGATTATCCGCGTCCATGATGTCAAAGAAACGGTAGAAGCGCTGCG
CGTGGTGGAAGCCACCCTCGCCGCTAAGGGAAAAAAACGTTATGAGTAA

>Sul|NC_002952.2860679|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
ATCAGCAGTAACTAGAGTGAAAGCGATGATGGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GCCATGAAATGATTACTGTGGAAGAAGAGTTGAATAGAGTATTACCAGTTGTTGAAGCGATTGTCGGTTTTGATGTAAAA
ATTTCGGTTGATACTTTTCGTAGTGAAGTTGCTGAAGCTTGTTTAAAGCTAGGTGTTGATATTATTAATGATCAATGGGC
AGGCCTTTATGATCATCGCATGTTTCAAGTTGTAGCCAAATACGATGCGGAAATTGTTTTAATGCATAATGGCAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATTTTTC
TTAA

>Sul|NC_008702.1.4608834|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCCGAATTTCGTATGCGGTCGGTTTGAACTCGATCTGACGCAGCCACGCATCATGGCCATCATCAACGTGACCGATGA
TTCATTCTCGGGTGATGGCTTGAGAGGAAATCTGGACGGGGCCTTGAATAAGGCGGAGCGTGCCCTGGCCGAAGGGGCGG
ATATCCTCGATCTCGGCGCGGAGTCCACCCGTCCGGGCAGTGATCCGGTACCCGAGCAGCAGGAGATCGACCGGCTGGTA
CCGCTTATCGAGGCCTTGCAGGGCTGCGGTGTGCCGCTATCGGTGGATACGCTGAAGCCTTCGGTGATGCGCGCCGCGCT
TGCGGCAGGTGCGGACCTGATCAACGACGTCAACGGATTCCGGGCGGAAGGCGCGGTCGAGGCTGTCGCGGCCGGCACAG
CGGGGCTCTGCGTGATGCACATGCAGGGCGAACCGCGGACGATGCAGCAGGCGCCCCAGTACGCCAATGTCGTCGATGAG
GTCGGCGCCTTTCTGGTTCGGCGAACGGAAGTGCTCCTGCGGGCAGGAGTCCGCCGCGAGCGGGTGTTGCTGGATCCCGG
ATTCGGTTTCGGCAAGAGCACCGAGCACAACCTGGCCCTGGTTCGCGGACTCGGGGCGCTGCGTGATCTCGGCTACCCGT
TGTTGGTGGGTTTGTCGCGCAAGAGTCTGTTGGGCGCGATTACCGGCAAGCCGGTGGAGGCGCGTGGTCCGGCCAGTGTG
GCTGCGGCGCTGATGGCGGTTCAGTACGGTGCCGCGATCGTTCGTGTGCACGATGTGGCGCCGACCCGCGATGCACTCGC
GGTGTGGCAAGCAATGTCATAA

>Sul|NC_002745.1123263|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGACTAAAACAAAAATTATGGGCATATTAAACGTCACACCTGATTCATTCTCAGATGGTGGAAAATTTAATAATGTTGA
AACAGCTATAAATAGAGTGAAAGCCATGATAGATGAAGGTGCTGACATTATAGATGTTGGAGGTGTTTCAACGAGACCCG
GTCATGAAATGGTTACATTAGAAGAAGAGCTGAACAGAGTATTACCTGTTGTTGAAGCTATTGTCGGTTTTGATGTAAAA
ATTTCAGTCGATACATTTCGAAGTGAGGTTGCTGAAGCATGTTTAAAATTAGGCGTTGATATGATTAATGATCAATGGGC
GGGTCTGTATGATCATCGTATGTTCCAAATTGTAGCTAAATATGACGCGGAAATTATTTTAATGCATAATGGAAATGGTA
ATCGTGATGAACCGGTTGTCGAAGAAATGTTAACATCTTTGTTAGCACAAGCACATCAAGCTAAAATAGCTGGTATACCT
TCAAATAAAATTTGGCTAGATCCAGGTATAGGTTTCGCTAAAACTAGAAATGAAGAAGCCGAAGTTATGGCAAGACTGGA
TGAACTTGTTGCAACAGAATATCCAGTTTTATTAGCGACAAGCCGGAAACGTTTCACTAAAGAGATGATGGGTTATGATA
CAACACCGGTTGAAAGAGATGAAGTAACTGCAGCTACGACTGCATATGGTATTATGAAAGGCGTTAGAGCAGTACGCGTT
CATAATGTCGAGTTGAATGCTAAATTAGCTAAAGGTATAGATTTTTTAAAGGAGAATGAAAATGCAAGACACAATCTTTC
TTAA

>CARD|pvgb|AE009949|878481-879282|ARO:3003387|Streptococcus|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAAATTGGAAGGTTTGTGATTGAGGGCAATGCGGCTATCATGGGGATTTTAAATGTGACTCCAGATTCTTTTTCAGA
TGGGGGGTCTTACACTACTGTGCAAAAAGCATTAGATCACGTTGAGCAAATGATTGCTGATGGTGCTAAAATCATCGACG
TTGGTGGAGAATCAACACGTCCAGGTTGCCAATTTGTAAGCGCTACCGATGAAATTGACAGGGTGGTTCCTGTGATCAAG
GCCATCAAAGAAAACTATGATATTCTAATCAGCATTGATACCTATAAAACCGAAACAGCTAGAGCAGCTTTAGAGGCGGG
TGCCGATATTCTCAATGATGTTTGGGCAGGTTTGTACGACGGTCAAATGTTTGCCTTAGCAGCCGAGTACGATGCGCCTA
TCATCTTGATGCATAACCAAGACGAAGAAGTTTATCAAGAGGTAACACAAGACGTTTGTGATTTTCTAGGCAATAGAGCA
CAAGCAGCTCTTGATGCTGGCGTGCCAAAAAACAATATTTGGATTGATCCAGGATTTGGATTTGCCAAATCTGTTCAACA
GAATACGGAGTTATTAAAAGGATTGGACCGCGTCTGTCAGTTGGGCTATCCTGTCTTGTTTGGTATTTCGAGAAAGCGTG
TCGTAGATGCCTTGTTAGGCGGCAATACCAAAGCTAAAGAGCGAGACGGAGCGACAGCAGCCTTGTCTGCTTATGCCCTT
GGAAAAGGCTGTCAGATTGTACGCGTACACGATGTCAAGGCTAATCAAGACATTGTGGCTGTGTTGAGCCAGTTGATGTG
AG

>Sul|NC_010400.5986775|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCAGTTAATATCTTTACCAAAGCAGATTTTACAGTGTGGACAGCTTCAATTAGATTTATCTCAGCCCCATGTTATGGG
TATCTTAAACGTCACTCCTGATTCTTTCAGTGATGGTGGCAAACATAACCAATTAGACCAAGCGGTTGACCATGCACTTA
GTATGATTGAGCAAGGCGCGACTATTATTGATATTGGGGGGGAGTCTACCCGTCCTGGTGCTTCAGAAGTTGCAGTAGAA
GAAGAAGTGCGTCGTGTGGTACCTGTCGTCGAGGCTTTATCTCACCATAACGTTATTTTGTCGATCGACACGAGTCAGCC
AGAAGTTATTCGCGCAGCAAAAGCAGCAGGGGCACATATCTGGAATGATGTTCGTGCCTTAACAGGTCCCAATGCTTTAA
AAACTGCCGTAGAGTTAGATATACCTGTAGTAATTATGCATATGCGCGGTGAGCCAACGACAATGAATCAGTTGGATCAG
TACACTGATGTAACACTCGATGTGATGCAAGAGCTGCAACAGCGTATTGATGAGGCTTTGGCTGCTGGGGTAAAAAAGCA
CAATATTATTGTTGATCCTGGATTTGGCTTTGCGAAAAATGCTCAGCAAAATTTAAAACTATTAAAAGAATTTTGGAAAC
TTAATGAACTTGGTTATCCAATTTTATCTGGCCTTTCTCGTAAACGTTTCATAGGTGAAGCTTTACAAGGCGCTCCTGCA
GATCAACGTGCTGTGGGAAGTGTAACTGGGCATTTGCTTAGTATTCAGCAGGGAGCATCTATTGTAAGAGCGCATGATGT
AAAGGAAATGCATGAAGCAATTTTAGTTTGGAAAGCGATGCAGCAAGCCTAA

>Sul|CP003248.2|gene3759|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGAGTCCGGCGCCCGTGCAGGTGATGGGGGTTCTAAACGTCACGGACGACTCTTTCTCGGACGGCGGGTGTTATCTCGA
TCTCGACGATGCGGTGAAGCACGGTCTGGCGATGGCAGCCGCAGGTGCGGGCATCGTCGACGTCGGTGGTGAGTCGAGCC
GGCCCGGTGCCACTCGGGTTGACCCGGCGGTGGAGACGTCTCGTGTCATACCCGTCGTCAAAGAGCTTGCAGCACAAGGC
ATCACCGTCAGCATCGATACCATGCGCGCGGATGTCGCTCGGGCGGCGTTGCAGAACGGTGCCCAGATGGTCAACGACGT
GTCGGGTGGGCGGGCCGATCCGGCGATGGGGCCGCTGTTGGCCGAGGCCGATGTGCCGTGGGTGTTGATGCACTGGCGGG
CGGTATCGGCCGATACCCCGCATGTGCCTGTGCGCTACGGCAACGTGGTGGCCGAGGTCCGTGCCGACCTGCTGGCCAGC
GTCGCCGACGCGGTGGCCGCAGGCGTCGACCCGGCAAGGCTGGTGCTCGATCCCGGGCTTGGATTCGCCAAGACGGCGCA
ACATAATTGGGCGATCTTGCATGCCCTTCCGGAACTGGTCGCGACCGGAATCCCAGTGCTGGTGGGTGCTTCGCGCAAGC
GCTTCCTCGGTGCGTTGTTGGCCGGGCCCGACGGCGTGATGCGGCCAACCGATGGGCGTGACACCGCGACGGCGGTGATT
TCCGCGCTGGCCGCACTGCACGGGGCCTGGGGTGTGCGGGTGCATGATGTGCGGGCCTCGGTCGATGCCATCAAGGTGGT
CGAAGCGTGGATGGGAGCGGAAAGGATAGAACGCGATGGCTGA

>Sul|CP0001138.1|gene3456|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGAAACTCTTCGCTCAGGGCGCCACGCTCGATCTCACTCATCCGCATGTTATGGGGATCCTGAACGTAACGCCGGATTC
GTTCTCCGACGGCGGCGCGCATAACACGCTGATTGAGGCGGTGAAACATGCGAATTTAATGGTGAATGCCGGGGCGACAA
TTATTGATGTGGGGGGGGAATCAACGCGACCAGGCGCGGCGGAAGTGAGCGTGGAAGAAGAGCTGGATCGCGTTATTCCG
GTACTGGAAGCAATCGCGCAACGTTTTGAAGTGTGGATTTCTGTGGATACCTCTAAACCCGAGGTGATCCGTGAAGCGGC
AAGGGCGGGCGCGCATATTATCAATGATGTCCGTTCGCTCTCCGAGCCCGGCGCGTTGGAAGCGGCAGCGGAAACCGGCT
TGCCGGTCAGTCTTATGCACATGCAGGGCAACCCCAAAACCATGCAGGAGGCGCCGAAATATGACGATGTCTTTGCCGAG
GTGAATCGCTACTTTATTGAGCAAATAGCACGTTGTGAGAAGGCCGGCATCGCAAAAGAGAAATTGTTGCTCGACCCCGG
ATTCGGTTTCGGTAAAAATCTCTCTCACAATTATACCTTACTGGCGCGACTGGGTGAGTTTCATCATTTTAACCTGCCGC
TGCTGGTGGGCATGTCACGTAAAACGATGGTTGGTCAGTTACTTAACGTGGGACCATCAGACCGTCTGAACGGCAGCCTT
GCGTGCGCGGTAATTGCCGCGATGCAGGGCGCGCAGATCATTCGCGTCCATGACGTCAAAGAAACCGTAGAGGCGATGCG
GGTGGTGGAAGCCACTCTGTCTGCAAAGGGAAACAAACGCTATGAGTAA

>Sul|NC_010410.6003232|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCAGTTAATATCTTTACCAAAGCAGATTTTACAGTGTGGACAGCTTCAATTAGATTTATCTCAGCCCCATGTTATGGG
TATCTTAAATGTCACTCCTGATTCTTTCAGTGATGGTGGTAAACATAACCAATTAGACCAAGCGGTTGATCATGCACTTA
GTATGATTGAGCAAGGCGCGACTATTATTGATATTGGGGGGGAATCTACCCGACCTGGTGCTTCAGAAGTTGTAGTAGAA
GAAGAAGTGCGTCGTGTGGTACCTGTGGTCGAGGCTTTATCTTACCATAACGTTATTTTGTCGATCGACACAAGTCAGCC
AGAAGTTATTCGCGCAGCAAAAGCAGCAGGGGCACATATCTGGAATGATGTCCGTGCCTTAACACGTCCCAATGCTTTAA
AAACTGCCGTAGAATTAGATATACCTGTAGTAATTATGCATATGCGCGGTGAACCAACGACAATGAATCAGTTGGATCAG
TACACTGATGTAACACTCGATGTGATGCAAGAGTTGCAACAGCGTATTGATGAGGCTTTGGCTGCTGGGGTAAAAAAGCA
CAATATTATTGTTGATCCTGGATTTGGCTTTGCGAAAAATGCCCAGCAAAATTTAAAACTATTAAAAGAATTTTGGAAAC
TTAATGAACTTGGTTATCCAATTTTATCCGGGCTTTCTCGTAAACGTTTCATAGGTGAAGCTTTACAAGGTGTTCCTGCA
GATCAACGTGCTGTGGGAAGTGTAACTGGGCATTTGCTTAGTATTCAGCAGGGAGCATCCATTGTAAGAGCGCATGATGT
AAAGGAAATGCATGAAGCAATTTTAGTTTGGAAAGCTATGCAGCAAGCCTAA

>Sul|AE000516.2|gene1302|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGCGTTCAACACCGCCGGCCTCAGCCGGTCGTTCAACACCGCCGGCGTTAGCCGGCCATTCAACACCGCCGGCGTTAGC
CGGCCATTCAACGCTGTGCGGCCGTCCAGTCGCAGGTGATCGTGCGCTGATCATGGCGATCGTCAACCGCACCCCGGATT
CGTTTTACGACAAGGGTGCGACTTTCAGCGACGCGGCTGCCAGAGACGCGGTCCACCGGGCCGTCGCCGACGGTGCCGAC
GTCATCGACGTCGGCGGTGTCAAAGCCGGCCCGGGTGAACGCGTCGACGTCGACACCGAGATCACGCGGCTGGTGCCGTT
CATCGAATGGCTCCGCGGTGCTTACCCGGACCAGCTGATCAGTGTCGACACCTGGCGCGCGCAGGTGGCGAAGGCGGCCT
GCGCGGCGGGGGCGGACCTGATCAACGACACCTGGGGTGGCGTCGACCCGGCCATGCCCGAGGTGGCCGCCGAGTTCGGC
GCGGGCCTGGTGTGTGCGCACACCGGCGGCGCGCTGCCACGCACGCGACCCTTCCGGGTGAGCTACGGTACGACTACCCG
CGGTGTGGTGGATGCTGTGATTAGCCAGGTCACAGCCGCCGCCGAGCGGGCCGTCGCGGCCGGGGTGGCCCGCGAGAAGG
TGTTGATCGACCCGGCACACGACTTCGGCAAGAACACCTTCCATGGGCTGCTGCTATTGCGACACGTGGCCGATCTTGTT
ATGACCGGGTGGCCCGTGCTGATGGCTTTGAGCAACAAGGACGTTGTCGGGGAGACTCTGGGCGTGGATTTGACCGAACG
GCTTGAGGGAACGCTGGCAGCCACCGCGTTGGCTGCGGCCGCCGGGGCGCGCATGTTTCGGGTGCATGAGGTCGCCGCCA
CCCGGCGGGTGCTGGAAATGGTGGCATCGATTCAGGGGGTCCGGCCGCCGACGCGCACGGTGAGAGGACTCGCATGA

>Sul|CP000034.1|gene3358|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
GTGCTCCGGGGTTTTTTCTTATCAATTCATACCAGGGATAACATCATGAAACTCTTTGCCCAGGGTACTTCACTGGACCT
TAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTCCTTTTCGGATGGTGGCACGCATAACTCGCTGATAG
ATGCGGTGAAACATGCGAATCTGATGATCAACGCTGGCGCGACGATCATTGACGTTGGTGGCGAGTCCACGCGGCCAGGG
GCGGCGGAAGTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCTGTGGTTGAGGCAATTGCTCAACGCTTCGAAGTCTG
GATCTCGGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGCGAAAGTTGGCGCTCACATTATTAACGATATCCGCT
CCCTTTCCGAACCTGGCGCTCTGGAGGCGGCTGCAGAAACCGGTTTACCGGTTTGTCTGATGCATATGCAGGGAAATCCA
AAAACCATGCAGGAAGCCCCGAAGTATGACGATGTCTTTGCAGAAGTGAATCGCTACTTTATTGAGCAAATAGCACGTTG
CGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGGATTCGGTTTCGGTAAAAATCTCTCCCATAACTATT
CATTACTGGCGCGCCTGGCTGAATTTCACCATTTCAACTTGCCGCTGTTGGTGGGTATGTCACGAAAATCGATGATTGGA
CAGCTGCTGAACGTGGGGCCGTCCGAGCGTTTGAGCGGTAGTCTGGCCTGTGCGGTCATTGCCGCAATGCAAGGCGCGCA
CATCATTGGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCGGGTGGTGGAAGCCACTCTGTCTGCAAAGGAAAACA
AACGCTATGAGTAA

>Sul|NC_012491.1.7719839|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGCCTGCCAAGCTTCGTGCGCGGCGCGAGTTGAACTGTGGCCAGTATGTTCTGCCACTGGGGGAGCGTACGCTAGTCAT
GGGAATTTTGAATGTGACACCTGATTCTTTCTCGGATGGCGGCCGTTATGTCAATGTGGAGGCAGCACTCGCACAAGCGC
GTGCAATGGTTGAGGCTGGAGCTGACCTGATTGATATCGGTGGAGAATCGACACGTCCGGGGTCGGAAGCAGTCGATGAG
GCGACGGAGCTGGACAGAGTGCTGCCAGTCATTCGGATGCTTTCGCAGGAATTGTCTGTTCCGCTGTCCATTGACACGTA
CAAAGCGGCGGTTGCAGAACGGGCTATTCTGGAGGGGGCACATATCATCAATGATGTATGGGGAGCGAAGCGTGACCCGC
GGATGGCAGAGGTAGCTGCTCGTCTCGATGTGCCCATTATCCTGATGCACAACCGCGAAGACACGGACTATCACGACTTT
TTCCCAAACTATATCAAAGACCTGCGTGAGTCCGTACAGATCGCCTTGCAGGCAGGGGTAAAGCAGGAGAGAATCATCCT
CGATCCGGGGATCGGGTTTGTAAGGACTGTCGAGCAAAATCTCGAAACAATGCGCAGGCTGGATGATCTGGTAGGGCTGG
GCTATCCTGTTCTACTTGCTACTTCACGCAAGCGGATGATCGGTCATGTTCTCGACTTGCCTGTAGATGAGCGTGTCGAA
GGTACGGCAGCGACAGTTGCTCTCGGGGCGGCAAAAGGCTGTCATATGGTACGGGTGCATGATGTCAAAGAAATGAAGCG
CGTTACGAAGATGATGGACGCGATGCTAAAAGGGGGCATTTAA

>Sul|CR628337.1|gene2815|Sulfonamides|Sulfonamide-resistant_dihydropteroate_synthases|FOLP|RequiresSNPConfirmation
ATGGGTGTCTTAAATGTTACCTCGGACTCATTTTATGATGGTGGCAAGTATCTGTCTGTTGATAGAGCCTGTGATCAGGC
TTTAAAATTAATTGCATGTGGAGCTGATCTCATTGATATAGGTGGGGAATCAACCAAACCTGGTGCGCCGCCAGTCCCTT
TAGATGTTGAACTATCAAGAGTTCTTCCCGTAATCAAACAACTTCGTGCCCTCGCAGATGTGTGTATTTCTATTGATACT
AATAAGCCTGAAGTGATGGAAGCGGCAATCGATGCTGGTGCGAATGTTATAAATGATGTTTATGCTTTAAGAAGGGATGG
TGCTTTGAATGTTGCTGCGCAGTTAGATGTTCCTGTTTGTTTAATGCACATGAAAGGAGAGCCTCGAACTATGCAAGAAA
ATCCTTCTTACCCAGAAGGAATAATGAAGGAATTACAGCATTTTTTTGAAGAGCGCATCGATAAATGCCAGAAAGCCGGG
CTGAATAAGAATAAATTAATTCTTGACCCTGGCTTTGGTTTTGGAAAGCGCATTAAAGATAACCTAAAATTAATTTATCA
TCTGAACGAATTGCGTTCTTTTGGATTGCCAATTCTTTTGGGCGTTTCACGCAAAAGCACAATTGGTGCTGTATTGAATA
ATGAAGTTGAGCAACGTTTGATTGGAAGTATTACGCTAGGAATATATGCTGCTCTTAAAGGCACTGCAATTATCAGGACA
CATGATGTGGATGAAACGAATCAAGCATTAACTATGATTAATGCAATTTATCAAGCTGCTAAAGAAATCAGTTAA