MEGAResFrom MEG, the Microbial Ecology Group

RGT

The rgt gene encodes a rifampin glycosyltransferase.

References

Sequences

Download Sequences

>CARD|phgb|JX028276|35585-36821|ARO:3002883|rgt1438|Rifampin|Rifampin_glycosyltransferase|RGT
TCACGGGGACACCGGCCGCCCCGCCCGGTCGGCGGTCTCGACGAGGAGCCGCGCGGCCACCGAGGCACCGTCCGTGCGGA
TGGTGCCCGCCACCGTCCGTGCCCGTGCCCGGACTTCGGGTGCCAGAGCCGTCGTCAGCGCGGCGGACAGGGAGTCGAAG
GTCACCACCGGGTCGGGATGAGCCGAGCCGATGCCGAGGTCCCTCACCCTCTCGGCCCAGTACGGCTGGTCCGCGATCCT
CGGAACCACCACCTGGGGCGCCCCCGCGCGGGCGGCCGTCGTCGTGGTCCCCGCCCCGCCGTGGTGCACCACGGCGGCCA
CCCGGCGGAACAGCGCCTGCTGGTTGACCTCGCCGACCGCGAAGCAGTCGGCACCGCCGTCGTCCGGAGTCAGCCCGGCC
CACCCGCGAGCGAGGACCACACGGCGCCCCTGCGCACGGCAGGCTTCGACGGCCACCCGGGCGATGCCCTCCGGAGCGTA
GGCGCCCATGCTGCCGAAGCCCACGTACACCGGTGGTGCCCCGGCGCCGAGGAACTCCTCCAGCCCGGCGGGCAGCGGAC
GTTCGTCCGGCAGGAACCACGGTCCGGTCTGTACGAGGTCGAACTCCGTCATCCCCTCCGCGGGACACAGCACCGGGTCC
GCTGCGAGCCACGGCCGGTCGGTGAGGACGTGGTCCCGGACGTTCCGCACGGGCGGCAGGCCGATCCCGGTGCGGTGACG
GTTGAGGGCGTCGCCGTACAGCGCGTTCACGCTCCGGGCGTCCTGTTCCCACAACTCCCGGTGGTCGGTCCCGTCCGGTG
CGGGCGGGGTGCCCGGACGCGCGCCCGGAGGAAAGTGCCGCGACGGCAGCCCGTAGATGTGGAAGCAGGCGAAGACGTAG
GGAATCCCCAGCTTCTCGGCCACGTCGCGGACACCGGCCGGCATCAACCCCGTGGCCAGCACCGCCTGACAACCCTCGGC
CGCCTCGGTGAGCGTGTCGAAGCGGGCGGTGACCAGTTCGGCGGCGAGCCGGAAGGCGTCCTGAGGTGTCGGTGGCCGCT
CACCGGCCACCACCGGACGCACCGGCGGGCCGAGCGGAATCAGCGGAACGCCCGCACGCGCCGGCAACGCCGCGAACTCC
TCGTCCGGCGGCGCGCACACCCGCGCCTCCACGCCCAACTTTCGCAATCCCGCCGCGAGTCCGGCCAGCGGCTCGACATC
TCCGCGCGATCCGTACGTGGTCAGCAGCATGCGCATG

>Rif|JX028276.1|gene31|Rifampin|Rifampin_glycosyltransferase|RGT
ATGCGCATGCTGCTGACCACGTACGGATCGCGCGGAGATGTCGAGCCGCTGGCCGGACTCGCGGCGGGATTGCGAAAGTT
GGGCGTGGAGGCGCGGGTGTGCGCGCCGCCGGACGAGGAGTTCGCGGCGTTGCCGGCGCGTGCGGGCGTTCCGCTGATTC
CGCTCGGCCCGCCGGTGCGTCCGGTGGTGGCCGGTGAGCGGCCACCGACACCTCAGGACGCCTTCCGGCTCGCCGCCGAA
CTGGTCACCGCCCGCTTCGACACGCTCACCGAGGCGGCCGAGGGTTGTCAGGCGGTGCTGGCCACGGGGTTGATGCCGGC
CGGTGTCCGCGACGTGGCCGAGAAGCTGGGGATTCCCTACGTCTTCGCCTGCTTCCACATCTACGGGCTGCCGTCGCGGC
ACTTTCCTCCGGGCGCGCGTCCGGGCACCCCGCCCGCACCGGACGGGACCGACCACCGGGAGTTGTGGGAACAGGACGCC
CGGAGCGTGAACGCGCTGTACGGCGACGCCCTCAACCGTCACCGCACCGGGATCGGCCTGCCGCCCGTGCGGAACGTCCG
GGACCACGTCCTCACCGACCGGCCGTGGCTCGCAGCGGACCCGGTGCTGTGTCCCGCGGAGGGGATGACGGAGTTCGACC
TCGTACAGACCGGACCGTGGTTCCTGCCGGACGAACGTCCGCTGCCCGCCGGGCTGGAGGAGTTCCTCGGCGCCGGGGCA
CCACCGGTGTACGTGGGCTTCGGCAGCATGGGCGCCTACGCTCCGGAGGGCATCGCCCGGGTGGCCGTCGAAGCCTGCCG
TGCGCAGGGGCGCCGTGTGGTCCTCGCTCGCGGGTGGGCCGGGCTGACTCCGGACGACGGCGGTGCCGACTGCTTCGCGG
TCGGCGAGGTCAACCAGCAGGCGCTGTTCCGCCGGGTGGCCGCCGTGGTGCACCACGGCGGGGCGGGGACCACGACGACG
GCCGCCCGCGCGGGGGCGCCCCAGGTGGTGGTTCCGAGGATCGCGGACCAGCCGTACTGGGCCGAGAGGGTGAGGGACCT
CGGCATCGGCTCGGCTCATCCCGACCCGGTGGTGACCTTCGACTCCCTGTCCGCCGCGCTGACGACGGCTCTGGCACCCG
AAGTCCGGGCACGGGCACGGACGGTGGCGGGCACCATCCGCACGGACGGTGCCTCGGTGGCCGCGCGGCTCCTCGTCGAG
ACCGCCGACCGGGCGGGGCGGCCGGTGTCCCCGTGA