MEGAResFrom MEG, the Microbial Ecology Group

RGT

The rgt gene encodes a rifampin glycosyltransferase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/22802246

Sequences

Download Sequences

>>MEG_6054|Drugs|Rifampin|Rifampin_glycosyltransferase|RGT
ATGCGCATGCTGCTGACCACGTACGGATCGCGCGGAGATGTCGAGCCGCTGGCCGGACTCGCGGCGGGATTGCGAAAGTT
GGGCGTGGAGGCGCGGGTGTGCGCGCCGCCGGACGAGGAGTTCGCGGCGTTGCCGGCGCGTGCGGGCGTTCCGCTGATTC
CGCTCGGCCCGCCGGTGCGTCCGGTGGTGGCCGGTGAGCGGCCACCGACACCTCAGGACGCCTTCCGGCTCGCCGCCGAA
CTGGTCACCGCCCGCTTCGACACGCTCACCGAGGCGGCCGAGGGTTGTCAGGCGGTGCTGGCCACGGGGTTGATGCCGGC
CGGTGTCCGCGACGTGGCCGAGAAGCTGGGGATTCCCTACGTCTTCGCCTGCTTCCACATCTACGGGCTGCCGTCGCGGC
ACTTTCCTCCGGGCGCGCGTCCGGGCACCCCGCCCGCACCGGACGGGACCGACCACCGGGAGTTGTGGGAACAGGACGCC
CGGAGCGTGAACGCGCTGTACGGCGACGCCCTCAACCGTCACCGCACCGGGATCGGCCTGCCGCCCGTGCGGAACGTCCG
GGACCACGTCCTCACCGACCGGCCGTGGCTCGCAGCGGACCCGGTGCTGTGTCCCGCGGAGGGGATGACGGAGTTCGACC
TCGTACAGACCGGACCGTGGTTCCTGCCGGACGAACGTCCGCTGCCCGCCGGGCTGGAGGAGTTCCTCGGCGCCGGGGCA
CCACCGGTGTACGTGGGCTTCGGCAGCATGGGCGCCTACGCTCCGGAGGGCATCGCCCGGGTGGCCGTCGAAGCCTGCCG
TGCGCAGGGGCGCCGTGTGGTCCTCGCTCGCGGGTGGGCCGGGCTGACTCCGGACGACGGCGGTGCCGACTGCTTCGCGG
TCGGCGAGGTCAACCAGCAGGCGCTGTTCCGCCGGGTGGCCGCCGTGGTGCACCACGGCGGGGCGGGGACCACGACGACG
GCCGCCCGCGCGGGGGCGCCCCAGGTGGTGGTTCCGAGGATCGCGGACCAGCCGTACTGGGCCGAGAGGGTGAGGGACCT
CGGCATCGGCTCGGCTCATCCCGACCCGGTGGTGACCTTCGACTCCCTGTCCGCCGCGCTGACGACGGCTCTGGCACCCG
AAGTCCGGGCACGGGCACGGACGGTGGCGGGCACCATCCGCACGGACGGTGCCTCGGTGGCCGCGCGGCTCCTCGTCGAG
ACCGCCGACCGGGCGGGGCGGCCGGTGTCCCCGTGA