MEGAResFrom MEG, the Microbial Ecology Group

embB

The arabinosyltransferases are the target of the drug ethambutol, which is used to inhibit the proliferation of Mycobacterium tuberculosis. Resistance to ethambutol can occur when the emb proteins, which encode the arabinosyltransferases, are overexpressed. The embB gene has also been specifically linked to resistance to isoniazid and rifampin.

References

Sequences

Download Sequences

>CARD|pvgb|AE000516|4238826-4242123|ARO:3003465|Mycobacterium|Rifampin|Rifampin-resistant_embB|embB|RequiresSNPConfirmation
ATGACACAGTGCGCGAGCAGACGCAAAAGCACCCCAAATCGGGCGATTTTGGGGGCTTTTGCGTCTGCTCGCGGGACGCG
CTGGGTGGCCACCATCGCCGGGCTGATTGGCTTTGTGTTGTCGGTGGCGACGCCGCTGCTGCCCGTCGTGCAGACCACCG
CGATGCTCGACTGGCCACAGCGGGGGCAACTGGGCAGCGTGACCGCCCCGCTGATCTCGCTGACGCCGGTCGACTTTACC
GCCACCGTGCCGTGCGACGTGGTGCGCGCCATGCCACCCGCGGGCGGGGTGGTGCTGGGCACCGCACCCAAGCAAGGCAA
GGACGCCAATTTGCAGGCGTTGTTCGTCGTCGTCAGCGCCCAGCGCGTGGACGTCACCGACCGCAACGTGGTGATCTTGT
CCGTGCCGCGCGAGCAGGTGACGTCCCCGCAGTGTCAACGCATCGAGGTCACCTCTACCCACGCCGGCACCTTCGCCAAC
TTCGTCGGGCTCAAGGACCCGTCGGGCGCGCCGCTGCGCAGCGGCTTCCCCGACCCCAACCTGCGCCCGCAGATTGTCGG
GGTGTTCACCGACCTGACCGGGCCCGCGCCGCCCGGGCTGGCGGTCTCGGCGACCATCGACACCCGGTTCTCCACCCGGC
CGACCACGCTGAAACTGCTGGCGATCATCGGGGCGATCGTGGCCACCGTCGTCGCACTGATCGCGTTGTGGCGCCTGGAC
CAGTTGGACGGGCGGGGCTCAATTGCCCAGCTCCTCCTCAGGCCGTTCCGGCCTGCATCGTCGCCGGGCGGCATGCGCCG
GCTGATTCCGGCAAGCTGGCGCACCTTCACCCTGACCGACGCCGTGGTGATATTCGGCTTCCTGCTCTGGCATGTCATCG
GCGCGAATTCGTCGGACGACGGCTACATCCTGGGCATGGCCCGAGTCGCCGACCACGCCGGCTACATGTCCAACTATTTC
CGCTGGTTCGGCAGCCCGGAGGATCCCTTCGGCTGGTATTACAACCTGCTGGCGCTGATGACCCATGTCAGCGACGCCAG
TCTGTGGATGCGCCTGCCAGACCTGGCCGCCGGGCTAGTGTGCTGGCTGCTGCTGTCGCGTGAGGTGCTGCCCCGCCTCG
GGCCGGCGGTGGAGGCCAGCAAACCCGCCTACTGGGCGGCGGCCATGGTCTTGCTGACCGCGTGGATGCCGTTCAACAAC
GGCCTGCGGCCGGAGGGCATCATCGCGCTCGGCTCGCTGGTCACCTATGTGCTGATCGAGCGGTCCATGCGGTACAGCCG
GCTCACACCGGCGGCGCTGGCCGTCGTTACCGCCGCATTCACACTGGGTGTGCAGCCCACCGGCCTGATCGCGGTGGCCG
CGCTGGTGGCCGGCGGCCGCCCGATGCTGCGGATCTTGGTGCGCCGTCATCGCCTGGTCGGCACGTTGCCGTTGGTGTCG
CCGATGCTGGCCGCCGGCACCGTCATCCTGACCGTGGTGTTCGCCGACCAGACCCTGTCAACGGTGTTGGAAGCCACCAG
GGTTCGCGCCAAAATCGGGCCGAGCCAGGCGTGGTATACCGAGAACCTGCGTTACTACTACCTCATCCTGCCCACCGTCG
ACGGTTCGCTGTCGCGGCGCTTCGGCTTTTTGATCACCGCGCTATGCCTGTTCACCGCGGTGTTCATCATGTTGCGGCGC
AAGCGAATTCCCAGCGTGGCCCGCGGACCGGCGTGGCGGCTGATGGGCGTCATCTTCGGCACCATGTTCTTCCTGATGTT
CACGCCCACCAAGTGGGTGCACCACTTCGGGCTGTTCGCCGCCGTAGGGGCGGCGATGGCCGCGCTGACGACGGTGTTGG
TATCCCCATCGGTGCTGCGCTGGTCGCGCAACCGGATGGCGTTCCTGGCGGCGTTATTCTTCCTGCTGGCGTTGTGTTGG
GCCACCACCAACGGCTGGTGGTATGTCTCCAGCTACGGTGTGCCGTTCAACAGCGCGATGCCGAAGATCGACGGGATCAC
AGTCAGCACAATCTTTTTCGCCCTGTTTGCGATCGCCGCCGGCTATGCGGCCTGGCTGCACTTCGCGCCCCGCGGCGCCG
GCGAAGGGCGGCTGATCCGCGCGCTGACGACAGCCCCGGTACCGATCGTGGCCGGTTTCATGGCGGCGGTGTTCGTCGCG
TCCATGGTGGCCGGGATCGTGCGACAGTACCCGACCTACTCCAACGGCTGGTCCAACGTGCGGGCGTTTGTCGGCGGCTG
CGGACTGGCCGACGACGTACTCGTCGAGCCTGATACCAATGCGGGTTTCATGAAGCCGCTGGACGGCGATTCGGGTTCTT
GGGGCCCCTTGGGCCCGCTGGGTGGAGTCAACCCGGTCGGCTTCACGCCCAACGGCGTACCGGAACACACGGTGGCCGAG
GCGATCGTGATGAAACCCAACCAGCCCGGCACCGACTACGACTGGGATGCGCCGACCAAGCTGACGAGTCCTGGCATCAA
TGGTTCTACGGTGCCGCTGCCCTATGGGCTCGATCCCGCCCGGGTACCGTTGGCAGGCACCTACACCACCGGCGCACAGC
AACAGAGCACACTCGTCTCGGCGTGGTATCTCCTGCCTAAGCCGGACGACGGGCATCCGCTGGTCGTGGTGACCGCCGCG
GGCAAGATCGCCGGCAACAGCGTGCTGCACGGGTACACCCCCGGGCAGACTGTGGTGCTCGAATACGCCATGCCGGGACC
CGGAGCGCTGGTACCCGCCGGGCGGATGGTGCCCGACGACCTATACGGAGAGCAGCCCAAGGCGTGGCGCAACCTGCGCT
TCGCCCGAGCAAAGATGCCCGCCGATGCCGTCGCGGTCCGGGTGGTGGCCGAGGATCTGTCGCTGACACCGGAGGACTGG
ATCGCGGTGACCCCACCGCGGGTACCGGACCTGCGCTCACTGCAGGAATATGTGGGCTCGACGCAGCCGGTGCTGCTGGA
CTGGGCGGTCGGTTTGGCCTTCCCGTGCCAGCAGCCGATGCTGCACGCCAATGGCATCGCCGAAATCCCGAAGTTCCGCA
TCACACCGGACTACTCGGCTAAGAAGCTGGACACCGACACGTGGGAAGACGGCACTAACGGCGGCCTGCTCGGGATCACC
GACCTGTTGCTGCGGGCCCACGTCATGGCCACCTACCTGTCCCGCGACTGGGCCCGCGATTGGGGTTCCCTGCGCAAGTT
CGACACCCTGGTCGATGCCCCTCCCGCCCAGCTCGAGTTGGGCACCGCGACCCGCAGCGGCCTGTGGTCACCGGGCAAGA
TCCGAATTGGTCCATAG

>CARD|pvgb|CP003248|4246691-4249988|ARO:3003465|Mycobacterium|Rifampin|Rifampin-resistant_embB|embB|RequiresSNPConfirmation
ATGACACAGTGCGCGAGCAGACGCAAAAGCACCCCAAATCGGGCGATTTTGGGGGCTTTTGCGTCTGCTCGCGGGACGCG
CTGGGTGGCCACCATCGCCGGGCTGATTGGCTTTGTGTTGTCGGTGGCGACGCCGCTGCTGCCCGTCGTGCAGACCACCG
CGATGCTCGACTGGCCACAGCGGGGGCAACTGGGCAGCGTGACCGCCCCGCTGATCTCGCTGACGCCGGTCGACTTTACC
GCCACCGTGCCGTGCGACGTGGTGCGCGCCATGCCACCCGCGGGCGGGGTGGTGCTGGGCACCGCACCCAAGCAAGGCAA
GGACGCCAATTTGCAGGCGTTGTTCGTCGTCGTCAGCGCCCAGCGCGTGGACGTCACCGACCGCAACGTGGTGATCTTGT
CCGTGCCGCGCGAGCAGGTGACGTCCCCGCAGTGTCAACGCATCGAGGTCACCTCTACCCACGCCGGCACCTTCGCCAAC
TTCGTCGGGCTCAAGGACCCGTCGGGCGCGCCGCTGCGCAGCGGCTTCCCCGACCCCAACCTGCGCCCGCAGATTGTCGG
GGTGTTCACCGACCTGACCGGGCCCGCGCCGCCCGGGCTGGCGGTCTCGGCGACCATCGACACCCGGTTCTCCACCCGGC
CGACCACGCTGAAACTGCTGGCGATCATCGGGGCGATCGTGGCCACCGTCGTCGCACTGATCGCGTTGTGGCGCCTGGAC
CAGTTGGACGGGCGGGGCTCAATTGCCCAGCTCCTCCTCAGGCCGTTCCGGCCTGCATCGTCGCCGGGCGGCATGCGCCG
GCTGATTCCGGCAAGCTGGCGCACCTTCACCCTGACCGACGCCGTGGTGATATTCGGCTTCCTGCTCTGGCATGTCATCG
GCGCGAATTCGTCGGACGACGGCTACATCCTGGGCATGGCCCGAGTCGCCGACCACGCCGGCTACATGTCCAACTATTTC
CGCTGGTTCGGCAGCCCGGAGGATCCCTTCGGCTGGTATTACAACCTGCTGGCGCTGATGACCCATGTCAGCGACGCCAG
TCTGTGGATGCGCCTGCCAGACCTGGCCGCCGGGCTAGTGTGCTGGCTGCTGCTGTCGCGTGAGGTGCTGCCCCGCCTCG
GGCCGGCGGTGGAGGCCAGCAAACCCGCCTACTGGGCGGCGGCCATGGTCTTGCTGACCGCGTGGATGCCGTTCAACAAC
GGCCTGCGGCCGGAGGGCATCATCGCGCTCGGCTCGCTGGTCACCTATGTGCTGATCGAGCGGTCCATGCGGTACAGCCG
GCTCACACCGGCGGCGCTGGCCGTCGTTACCGCCGCATTCACACTGGGTGTGCAGCCCACCGGCCTGATCGCGGTGGCCG
CGCTGGTGGCCGGCGGCCGCCCGATGCTGCGGATCTTGGTGCGCCGTCATCGCCTGGTCGGCACGTTGCCGTTGGTGTCG
CCGATGCTGGCCGCCGGCACCGTCATCCTGACCGTGGTGTTCGCCGACCAGACCCTGTCAACGGTGTTGGAAGCCACCAG
GGTTCGCGCCAAAATCGGGCCGAGCCAGGCGTGGTATACCGAGAACCTGCGTTACTACTACCTCATCCTGCCCACCGTCG
ACGGTTCGCTGTCGCGGCGCTTCGGCTTTTTGATCACCGCGCTATGCCTGTTCACCGCGGTGTTCATCATGTTGCGGCGC
AAGCGAATTCCCAGCGTGGCCCGCGGACCGGCGTGGCGGCTGATGGGCGTCATCTTCGGCACCATGTTCTTCCTGATGTT
CACGCCCACCAAGTGGGTGCACCACTTCGGGCTGTTCGCCGCCGTAGGGGCGGCGATGGCCGCGCTGACGACGGTGTTGG
TATCCCCATCGGTGCTGCGCTGGTCGCGCAACCGGATGGCGTTCCTGGCGGCGTTATTCTTCCTGCTGGCGTTGTGTTGG
GCCACCACCAACGGCTGGTGGTATGTCTCCAGCTACGGTGTGCCGTTCAACAGCGCGATGCCGAAGATCGACGGGATCAC
AGTCAGCACAATCTTTTTCGCCCTGTTTGCGATCGCCGCCGGCTATGCGGCCTGGCTGCACTTCGCGCCCCGCGGCGCCG
GCGAAGGGCGGCTGATCCGCGCGCTGACGACAGCCCCGGTACCGATCGTGGCCGGTTTCATGGCGGCGGTGTTCGTCGCG
TCCATGGTGGCCGGGATCGTGCGACAGTACCCGACCTACTCCAACGGCTGGTCCAACGTGCGGGCGTTTGTCGGCGGCTG
CGGACTGGCCGACGACGTACTCGTCGAGCCTGATACCAATGCGGGTTTCATGAAGCCGCTGGACGGCGATTCGGGTTCTT
GGGGCCCCTTGGGCCCGCTGGGTGGAGTCAACCCGGTCGGCTTCACGCCCAACGGCGTACCGGAACACACGGTGGCCGAG
GCGATCGTGATGAAACCCAACCAGCCCGGCACCGACTACGACTGGGATGCGCCGACCAAGCTGACGAGTCCTGGCATCAA
TGGTTCTACGGTGCCGCTGCCCTATGGGCTCGATCCCGCCCGGGTACCGTTGGCAGGCACCTACACCACCGGCGCACAGC
AACAGAGCACACTCGTCTCGGCGTGGTATCTCCTGCCTAAGCCGGACGACGGGCATCCGCTGGTCGTGGTGACCGCCGCG
GGCAAGATCGCCGGCAACAGCGTGCTGCACGGGTACACCCCCGGGCAGACTGTGGTGCTCGAATACGCCATGCCGGGACC
CGGAGCGCTGGTACCCGCCGGGCGGATGGTGCCCGACGACCTATACGGAGAGCAGCCCAAGGCGTGGCGCAACCTGCGCT
TCGCCCGAGCAAAGATGCCCGCCGATGCCGTCGCGGTCCGGGTGGTGGCCGAGGATCTGTCGCTGACACCGGAGGACTGG
ATCGCGGTGACCCCGCCGCGGGTACCGGACCTGCGCTCACTGCAGGAATATGTGGGCTCGACGCAGCCGGTGCTGCTGGA
CTGGGCGGTCGGTTTGGCCTTCCCGTGCCAGCAGCCGATGCTGCACGCCAATGGCATCGCCGAAATCCCGAAGTTCCGCA
TCACACCGGACTACTCGGCTAAGAAGCTGGACACCGACACGTGGGAAGACGGCACTAACGGCGGCCTGCTCGGGATCACC
GACCTGTTGCTGCGGGCCCACGTCATGGCCACCTACCTGTCCCGCGACTGGGCCCGCGATTGGGGTTCCCTGCGCAAGTT
CGACACCCTGGTCGATGCCCCTCCCGCCCAGCTCGAGTTGGGCACCGCGACCCGCAGCGGCCTGTGGTCACCGGGCAAGA
TCCGAATTGGTCCATAG