MEGAResFrom MEG, the Microbial Ecology Group

RPOB

The rpoB gene encodes the beta subunit of the 30S rRNA polymerase. Mutations in this protein have been linked with resistance to rifampin (primarily) and also lipopeptides and glycopeptides, though this second mechanism is less clearly described.

References

Sequences

Download Sequences

>Rif|CP003248.2|gene696|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGATTCCCGCCAGAGCAAAACAGCCGCTAGTCCTAGTCCGAGTCGCCCGCAAAGTTCCTCGAATAACTCCGTACC
CGGAGCGCCAAACCGGGTCTCCTTCGCTAAGCTGCGCGAACCACTTGAGGTTCCGGGACTCCTTGACGTCCAGACCGATT
CGTTCGAGTGGCTGATCGGTTCGCCGCGCTGGCGCGAATCCGCCGCCGAGCGGGGTGATGTCAACCCAGTGGGTGGCCTG
GAAGAGGTGCTCTACGAGCTGTCTCCGATCGAGGACTTCTCCGGGTCGATGTCGTTGTCGTTCTCTGACCCTCGTTTCGA
CGATGTCAAGGCACCCGTCGACGAGTGCAAAGACAAGGACATGACGTACGCGGCTCCACTGTTCGTCACCGCCGAGTTCA
TCAACAACAACACCGGTGAGATCAAGAGTCAGACGGTGTTCATGGGTGACTTCCCGATGATGACCGAGAAGGGCACGTTC
ATCATCAACGGGACCGAGCGTGTGGTGGTCAGCCAGCTGGTGCGGTCGCCCGGGGTGTACTTCGACGAGACCATTGACAA
GTCCACCGACAAGACGCTGCACAGCGTCAAGGTGATCCCGAGCCGCGGCGCGTGGCTCGAGTTTGACGTCGACAAGCGCG
ACACCGTCGGCGTGCGCATCGACCGCAAACGCCGGCAACCGGTCACCGTGCTGCTCAAGGCGCTGGGCTGGACCAGCGAG
CAGATTGTCGAGCGGTTCGGGTTCTCCGAGATCATGCGATCGACGCTGGAGAAGGACAACACCGTCGGCACCGACGAGGC
GCTGTTGGACATCTACCGCAAGCTGCGTCCGGGCGAGCCCCCGACCAAAGAGTCAGCGCAGACGCTGTTGGAAAACTTGT
TCTTCAAGGAGAAGCGCTACGACCTGGCCCGCGTCGGTCGCTATAAGGTCAACAAGAAGCTCGGGCTGCATGTCGGCGAG
CCCATCACGTCGTCGACGCTGACCGAAGAAGACGTCGTGGCCACCATCGAATATCTGGTCCGCTTGCACGAGGGTCAGAC
CACGATGACCGTTCCGGGCGGCGTCGAGGTGCCGGTGGAAACCGACGACATCGACCACTTCGGCAACCGCCGCCTGCGTA
CGGTCGGCGAGCTGATCCAAAACCAGATCCGGGTCGGCATGTCGCGGATGGAGCGGGTGGTCCGGGAGCGGATGACCACC
CAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCAC
CAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGC
CCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATC
GAAACCCCTGAGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAACCCGTTCGGGTTCATCGA
AACGCCGTACCGCAAGGTGGTCGACGGCGTGGTTAGCGACGAGATCGTGTACCTGACCGCCGACGAGGAGGACCGCCACG
TGGTGGCACAGGCCAATTCGCCGATCGATGCGGACGGTCGCTTCGTCGAGCCGCGCGTGCTGGTCCGCCGCAAGGCGGGC
GAGGTGGAGTACGTGCCCTCGTCTGAGGTGGACTACATGGACGTCTCGCCCCGCCAGATGGTGTCGGTGGCCACCGCGAT
GATTCCCTTCCTGGAGCACGACGACGCCAACCGTGCCCTCATGGGGGCAAACATGCAGCGCCAGGCGGTGCCGCTGGTCC
GTAGCGAGGCCCCGCTGGTGGGCACCGGGATGGAGCTGCGCGCGGCGATCGACGCCGGCGACGTCGTCGTCGCCGAAGAA
AGCGGCGTCATCGAGGAGGTGTCGGCCGACTACATCACTGTGATGCACGACAACGGCACCCGGCGTACCTACCGGATGCG
CAAGTTTGCCCGGTCCAACCACGGCACTTGCGCCAACCAGTGCCCCATCGTGGACGCGGGCGACCGAGTCGAGGCCGGTC
AGGTGATCGCCGACGGTCCCTGTACTGACGACGGCGAGATGGCGCTGGGCAAGAACCTGCTGGTGGCCATCATGCCGTGG
GAGGGCCACAACTACGAGGACGCGATCATCCTGTCCAACCGCCTGGTCGAAGAGGACGTGCTCACCTCGATCCACATCGA
GGAGCATGAGATCGATGCTCGCGACACCAAGCTGGGTGCGGAGGAGATCACCCGCGACATCCCGAACATCTCCGACGAGG
TGCTCGCCGACCTGGATGAGCGGGGCATCGTGCGCATCGGTGCCGAGGTTCGCGACGGGGACATCCTGGTCGGCAAGGTC
ACCCCGAAGGGTGAGACCGAGCTGACGCCGGAGGAGCGGCTGCTGCGTGCCATCTTCGGTGAGAAGGCCCGCGAGGTGCG
CGACACTTCGCTGAAGGTGCCGCACGGCGAATCCGGCAAGGTGATCGGCATTCGGGTGTTTTCCCGCGAGGACGAGGACG
AGTTGCCGGCCGGTGTCAACGAGCTGGTGCGTGTGTATGTGGCTCAGAAACGCAAGATCTCCGACGGTGACAAGCTGGCC
GGCCGGCACGGCAACAAGGGCGTGATCGGCAAGATCCTGCCGGTTGAGGACATGCCGTTCCTTGCCGACGGCACCCCGGT
GGACATTATTTTGAACACCCACGGCGTGCCGCGACGGATGAACATCGGCCAGATTTTGGAGACCCACCTGGGTTGGTGTG
CCCACAGCGGCTGGAAGGTCGACGCCGCCAAGGGGGTTCCGGACTGGGCCGCCAGGCTGCCCGACGAACTGCTCGAGGCG
CAGCCGAACGCCATTGTGTCGACGCCGGTGTTCGACGGCGCCCAGGAGGCCGAGCTGCAGGGCCTGTTGTCGTGCACGCT
GCCCAACCGCGACGGTGACGTGCTGGTCGACGCCGACGGCAAGGCCATGCTCTTCGACGGGCGCAGCGGCGAGCCGTTCC
CGTACCCGGTCACGGTTGGCTACATGTACATCATGAAGCTGCACCACCTGGTGGACGACAAGATCCACGCCCGCTCCACC
GGGCCGTACTCGATGATCACCCAGCAGCCGCTGGGCGGTAAGGCGCAGTTCGGTGGCCAGCGGTTCGGGGAGATGGAGTG
CTGGGCCATGCAGGCCTACGGTGCTGCCTACACCCTGCAGGAGCTGTTGACCATCAAGTCCGATGACACCGTCGGCCGCG
TCAAGGTGTACGAGGCGATCGTCAAGGGTGAGAACATCCCGGAGCCGGGCATCCCCGAGTCGTTCAAGGTGCTGCTCAAA
GAACTGCAGTCGCTGTGCCTCAACGTCGAGGTGCTATCGAGTGACGGTGCGGCGATCGAACTGCGCGAAGGTGAGGACGA
GGACCTGGAGCGGGCCGCGGCCAACCTGGGAATCAATCTGTCCCGCAACGAATCCGCAAGTGTCGAGGATCTTGCGTAA

>Rif|NC_003098.1.933647|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGACAAGGCTTGGAACTTATTTACAAAGGAGAATCATCTTGGCAGGACATGACGTTCAATACGGGAAACATCGTACCCG
TCGTAGTTTTTCAAGAATCAAAGAAGTTCTTGACTTACCAAATTTGATTGAAATTCAAACTGACTCATTCAAAGCTTTCC
TAGACCACGGTCTTAAGGAAGTGTTTGAAGATGTATTGCCAATTTCAAACTTCACAGACACAATGGAGTTGGAATTTGTT
GGATATGAAATCAAGGAACCAAAATACACGCTAGAAGAAGCTCGTATCCACGATGCTAGCTACTCAGCACCAATTTTTGT
AACCTTCCGTTTGATCAATAAAGAAACAGGCGAAATCAAGACCCAAGAAGTTTTCTTTGGTGATTTCCCAATCATGACAG
AAATGGGTACTTTCATCATCAATGGTGGTGAACGTATTATCGTTTCTCAGTTGGTCCGCTCACCAGGTGTTTACTTTAAC
GACAAAGTAGACAAAAATGGTAAGGTGGGCTATGGTTCAACTGTTATCCCTAACCGTGGAGCTTGGTTGGAACTTGAAAG
CGACTCAAAAGATATCACCTACACTCGTATCGACCGTACTCGTAAGATTCCATTTACAACCTTGGTTCGTGCTCTTGGTT
TCTCAGGTGATGATGAAATCTTTGATATCTTTGGTGACAGCGAATTGGTTCGCAACACTGTTGAAAAAGATATCCACAAG
AATCCAATGGACTCTCGTACAGACGAAGCCTTGAAAGAAATTTACGAACGCCTTCGTCCAGGTGAGCCTAAGACAGCTGA
AAGCTCACGTAGCTTGCTTGTGGCTCGCTTCTTTGACCCACGTCGCTATGACTTGGCAGCAGTTGGTCGTTACAAAATCA
ATAAAAAACTCAATGTTAAAACACGTTTGCTCAACCAAACCATTGCAGAGCCATTGGTAGACCCTGAAACTGGAGAAATC
TTGGTAGAAGCTGGTACGATTATGACTCGTAGCGTGATTGAAAGCATTGAAAGCCATTTGGATGGCGACTTGAACAAGAT
TGTCTACATCCCAAACGATGCAGCCGTTGTGACTGAGCCTGTTGTTCTTCAAAAATTCAAGGTTGTTGCTCCAACTGATC
CAGATCGCGTCGTAACGATCATTGGTAATGCTAACCCAGATGACAAGGTTCGTACGGTGACTCCTGCAGATATCCTTGCT
GAGATGAGCTACTTCCTCAACTTGGCTGAAGGACTTGGCCGTGTAGATGATATCGACCACCTTGGAAATCGTCGTATCCG
TGCGGTTGGTGAATTGCTTGCCAACCAAGTACGTTTGGGACTTTCTCGTATGGAACGTAATGTCCGTGAACGTATGTCTG
TTCAGGACAATGAAGTCTTGACACCACAACAAATTATCAATATCCGTCCTGTAACAGCTGCAGTTAAAGAATTCTTTGGT
TCATCACAGTTGTCACAGTTCATGGACCAACACAACCCGCTTTCTGAGTTGTCTCACAAACGCCGTTTGTCAGCCTTAGG
ACCTGGTGGTTTGACTCGTGACCGTGCCGGATATGAAGTGCGTGACGTGCACTACACTCACTATGGTCGTATGTGTCCAA
TCGAAACACCTGAAGGACCTAACATCGGTTTGATCAATAACTTGTCATCTTACGGACACTTGAACAAATATGGTTTTGTT
CAAACACCATACCGTAAGGTTGACCGTGAAACAGGTGTTGTCACGAACGAAATTGTTTGGTTGACAGCTGATGAAGAAGA
TGAATATACTGTAGCTCAGGCTAACTCTCGTCTGAATGAAGATGGAACCTTTGCTGAGAAGATTGTCATGGGACGTCACC
AAGGGGTCAACCAAGAGTATCCAGCTAATATTGTTGACTACATGGACGTTTCACCAAAACAGGTAGTTGCCGTTGCGACA
GCATGTATTCCTTTCTTGGAAAACGATGACTCCAACCGTGCCCTCATGGGAGCCAATATGCAACGTCAGGCTGTGCCATT
GATTAATCCTCAGGCACCTTACGTTGGTACTGGTATGGAATACCAAGCAGCCCACGATTCTGGTGCGGCTGTGATTGCTC
AGTATGATGGTAAAGTTACTTACGCAGATGCTGACAAGGTAGAAGTTCGTCGTGAAGATGGTTCATTGGATGTTTACCAC
ATCCAAAAATTCCGTCGTTCAAACTCAGGTACTGCTTACAACCAACGCACTCTCGTAAAAGTTGGTGATGTCGTTGAAAA
AGGCGATTTCATCGCTGACGGACCTTCTATGGAAAATGGAGAAATGGCGCTTGGACAAAACCCAATCGTTGCCTACATGA
CTTGGGAAGGTTACAACTTCGAGGATGCCGTTATCATGAGCGAACGCTTGGTGAAGGACGATGTCTACACATCTGTTCAC
CTTGAAGAATACGAATCAGAAACGCGCGATACAAAGCTTGGGCCTGAAGAAATCACTCGCGAAATTCCAAACGTTGGTGA
AGATGCCCTCAAAGACCTTGACGAAATGGGGATTATCCGTATTGGTGCTGAGGTTAAAGAAGGTGATATTCTTGTAGGTA
AAGTAACACCTAAGGGTGAGAAAGATCTTTCAGCTGAAGAACGTCTCTTGCACGCTATCTTTGGAGACAAGTCTCGTGAA
GTGCGTGATACTTCTCTTCGTGTACCACACGGTGCCGATGGTGTCGTTCGTGATGTTAAGATCTTTACACGTGTAAATGG
AGATGAGTTGCAATCAGGTGTTAACATGTTGGTTCGTGTTTACATCGCTCAAAAACGTAAGATTAAGGTCGGAGATAAAA
TGGCCGGACGTCACGGAAACAAAGGGGTTGTCTCTCGTATCGTTCCTGTAGAAGACATGCCTTACCTTCCAGACGGAACT
CCAGTCGACATCATGTTGAACCCACTTGGGGTGCCATCACGTATGAATATCGGTCAGGTTATGGAGCTTCACCTTGGTAT
GGCAGCTCGTACTCTTGGTATTCACATTGCGACACCAGTCTTTGATGGAGCAAGTTCTGAAGATCTTTGGTCAACTGTTA
AAGAAGCAGGTATGGATAGCGATGCCAAGACAATCCTTTACGATGGACGTACAGGTGAACCATTTGATAACCGTGTTTCT
GTTGGAGTCATGTACATGATCAAACTCCACCACATGGTTGACGATAAATTGCACGCGCGTTCAGTCGGACCTTACTCAAC
TGTTACCCAACAACCACTCGGAGGTAAAGCTCAGTTTGGTGGACAACGTTTCGGTGAGATGGAGGTTTGGGCTCTTGAAG
CCTACGGTGCGTCAAATGTCCTTCAAGAAATCTTGACTTACAAGTCGGACGATATCAACGGACGTTTGAAAGCCTATGAA
GCTATTACAAAAGGCAAACCAATTCCAAAACCAGGTGTTCCAGAATCCTTCCGAGTTCTTGTCAAAGAATTGCAATCTCT
TGGTCTTGACATGCGTGTCCTAGACGAAGATGACCAAGAAGTGGAACTTCGCGACTTGGATGAAGGAATGGACGAAGATG
TCATCCACGTAGATGACCTTGAAAAAGCCCGCGAAAAAGCAGCCCAAGAGGCTAAAGCAGCCTTTGAAGCTGAAGAAGCT
GAGAAAGCAACAAAAGCGGAAGCAACAGAAGAAGCTGCTGAACAAGAATAA

>Rif|NC_007793.3914836|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGCGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAACCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCGGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTTCGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATCGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTTGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>Rif|AP010904.1|gene3156|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCCCAGCTGACCAAAAATTTCGGCAAGATCGTCAAAACGCTGACCATTCCCCATCTGCTCAATCTGCAGATCGACTC
CTACGAGCTGTTTCTGCAAAAAGATATTCCTCCCACCAGCCGGGAGGACGCGGGACTTGAAGGCGTCTTCCGTTCGGTCT
TTCCCATCGAGGACTTCAATCGCACCGCCTCGCTGGAATACGTCAGCTACGAAATCGGCGAACCGAAATACGACGTGCCC
GAGTGTATCGCCAAAGGCCTGACCTTCGAGGCGCCCCTGCGCATCAAGGTCCGCCTGGTCGTGTACGACGTGGATGAAGA
GACGGAAAACCGCACCATCCGGGACATCAAGGAACAGATCATCTATTTCGGTACCGTGCCGCTTATGACCGAGAAAGGCA
CGTTTATCATCAACGGCACCGAGCGCGTCATCGTCAACCAGCTCCAGCGCTCCCCGGGCATCATCTTCGAGCACGACTCC
GGTAAAAGCCACACCAGCCGCAAGGTCCTCTATTCCTGCCGCATCATCCCCATGCGCGGCTCCTGGCTCGACTTCGACTA
CGACCACAAGGACATCCTGTACGTGCGCATCGACCGCCGCCGCAAGATGCCCGCCACCATCCTGTTCAAGGCCATGGGCA
TGTCGCGCGCCGACATCCTGCGCTATTTCTACGAGGTCGAACACTTCACCTTCGAGCCGCATCACGTCTTCCGCCAGGTC
CTTCCCGATTTCTACCGCAAGGAGAAGGCCTATTCCGAGATTCGCGACAGCGAGGGCAAGGTCATTGTCGCTGTGGACAA
GCCCATCACCAAACGGGCTTGGCGGCTCATGCTCGAAGCCGGCATCGAGAAGGTCGAGGTCGATCCGGCCACGCTGCTGG
GGCTGTTCCTGGCCGAGGACCTGGCCGATCCGGCCACCGGCGAAGTGATGGCCGAGGCCGGAGACGAACTCAACGCCGAC
CTCATCGAGAAGCTCAAGGACGCCGGCATCGTCGAGCTCTCGCTGCTGCACACCCGGGGCGTGGACACCTCGTCGTCCAT
TCGCGACACGTTGGCCCTCGACAAGACCATCGACACCATCACGGCCCAGGTGGAAATCTACCGCCGCCTGCGTCCGTCCT
CGCCGCCGACTCCGGAAATCGCGGCCAACTTCTTTGAGAACCTGTTCCGCAATCCGGACTACTACGACCTGTCCCCGGTG
GGCCGCTACAAGATCAATGCGCGCCTCAAGGTGGATCAGCCGCTGGATTTCCGCACCCTGGCCAACGACGACATCCTCAA
GGCCGTCAAGCACCTGACATTCCTCAAGGATTCCCACGGTCCGGCCGACGACATCGACCACCTGGGCAACCGCCGGGTGC
GTCCCGTGGGCGAGCTGGTCGAGAACCAGTACCGCATCGGGCTTGTGCGCATGGAGCGTGCCATCAAGGAGCGCATGAGC
CTTCAGGAAGTGGCCACCCTCATGCCCCACGACCTCATCAACCCCAAGCCCGTGGCCGCGGTCCTCAAGGAATTCTTCGG
CACCTCCCAGCTGTCGCAGTTCATGGACCAGACCAACCCGCTCTCGGAAGTCACCCACAAGCGCCGCCTGTCGGCCCTTG
GACCGGGCGGCCTCACCCGCGAGCGCGCCGGCTTCGAGGTCCGCGACGTCCACACCTCGCACTACGGCCGCATCTGCCCC
ATCGAAACGCCGGAAGGCCCGAACATCGGTCTTATCGTGTCCTTGACCACCCACTCCAAGGTCAACGACTTCGGCTTCAT
CGAGACGCCCTATAAGGTCGTCAAGGACGGCCAGCTCACCGGCGAGACCATCTACCTCGACGCCACCCGCGAAATCGACG
AGGTCATCGCCGGCGCCAACGCGCCCCTGGACGAGAACAAGGCCTTCATCAACTCCATGGTCGGCGCGCGCATTCGCGGC
GACCAGGTGGTGATCCCGCGCGAGCAGGTCACCTTGATGGATATTTCGCCGAGCCAAATCGTGTCCGTTTCGGCCGCGCT
CATCCCGTTCCTTGAACACGACGACGCCAACCGCGCCCTCATGGGTTCGAACATGCAGCGCCAGGCCGTGCCGCTTTTGC
GCTGCGAGCAGCCGCTGGTCGGCACCGGCATGGAAGGCGCGGTGGCCAAGGATTCCGGCTCCTGCATCCTGGCCGAGGGC
GAGGGCTTCGTCCACTACGCCGACGCCGAGCGCATCATCGTGTGCTACGACGATCCGGCCGTGGGCACGGACACCGGTTC
GGCCAAGACCTACGAACTGCTCAAACACCACAAGTCCAACCAGAACACTTGCTTCGGCCAGGTGCCGCGCGTGCTGGTCG
GGCAGCGGGTGGTCAAGGGCGACGTCCTGGCCGACGGCCCGGGCATCCGCGACGGCGAACTGGCCCTGGGCAAGAACCTG
CTGGTCGCGTTCATGCCCTGGTGCGGCTACAACTACGAAGACTCCATCCTCATTTCCGAAAATGCGGTCAAGGACGACAC
CTTCACCTCGGTGCACATCGAGGAGTTCGAGGTCGTGGCCCGCGACACCAAGCTCGGACCTGAGGAAATCACCCGCGATA
TTCCCAACGTCGGCGAGGAGATGCTCAAAGACCTCGACGACTGCGGCATCATCCGCATTGGCGCCCGTGTGGCCCCGGAC
GACATCCTGGTCGGCAAGATCACGCCCAAGGGCGAGACCCAGCTGACCCCCGAAGAAAAGCTCCTGCGGGCCATCTTCGG
CGACAAGGCCCGGGACGTCAAAAACACCTCGCTGAAGGTTCCGCCCGGAATCGAGGGCACGGTCATCGACGTGCGCGTGT
TCAACCGCCGCTCCGGCGAGAAGGACGACCGCACCCGCCAGATCGAGGACTTCGAGCTGGCCCGCCTGGACACCAAGGAA
GGCCAGCACGCCGCCGCCATCGCCGCCAACGTGCGTCGCCGGCTGTGGCCGGTGGTCTCGGGCAAGACCGTGTTCCAGAC
CATAAAGGGCGTGAAGAAAGGCGAAGTGCTTCTCGAAGCCAACCACCCCATGACCCAGGAGGTCCTGGAGGCGCTGCCGG
TCAAGAAATTGTCCGGGCTTTTTACCTCCAAGGAGACCAACGAGGCCGTGGCCGAGGTGCTGGACGAGTACGACCGCCAC
ATCCAGTTCATCAAGGGCCTCTACGACCAGAAGCGCGAGAAGACCACCGAGGGCGACGATCTGCCGCCTGGCGTCATCAA
GATGGTCAAGGTCTACGTGGCGGTGAAGCGCAAGCTCAACGTCGGCGATAAAATGGCCGGCCGCCACGGCAACAAGGGCG
TCGTGTCCTGCATCCTGCCCATCGAGGACATGCCCTTTTTCTCCCACGGCCGTCCCGTGGACATCGTGCTCAACCCCCTG
GGCGTGCCTTCGCGTATGAACATCGGCCAGATCCTCGAAACCCACCTGGGCTGGGCCGGCATGGAGCTTGGCCGCCAGTT
GGCCGAGATGGTCGATTCCGGCAAGGCCATGGAAGGCGTGCGCGACCGGGCCAAGGCGGTCTTCGACACCGAAGAGACCA
CGGCCCTTATCGACGGCATGTCCGACGACGACCTGCGTGATGCCCTGCGCGCGCTCAAAAACGGCATCGTGGCCAAGACC
CCGGTCTTTGACGGCGCCACCGAAGACGAGCTGTGGAGCTGGCTCAAGCTGGCCGGCCTGCCCGAGGACGGCAAGGTCAC
CCTCTACGACGGCCGCACCGGCGAGGCTTTCCACCGGCCGGTCACCGTGGGGTGCATGTACATCTTAAAGCTCCACCACT
TGGTCGACGAGAAGATCCACGCCCGTTCCACTGGCCCGTACTCCCTGGTCACCCAGCAGCCGCTGGGCGGCAAGGCCCAG
TTCGGCGGCCAGCGTCTGGGTGAAATGGAAGTCTGGGCCCTGGAAGCCTACGGCGCGTCGTACCTCCTGCAGGAGTTCTT
GACCGTCAAGTCCGACGACGTCGGCGGCCGCGTCAAGATGTACGAGAAGATCGTCAAGGGCGACAATTTCCTGGAAGCCG
GGTTGCCCGAGTCCTTCAACGTCTTGGTCAAGGAACTCATGTCCCTGGGCCTCGACGTGGACCTCATCCAGGACGAAAAA
AAGATCGCTAAGGCTCCGCCGCGGCGCTAG

>Rif|CP000034.1|gene3741|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTACCTTATCT
CCTTTCTATCCAGCTTGACTCGTTTCAGAAATTTATCGAGCAAGATCCTGAAGGGCAGTATGGTCTGGAAGCTGCTTTCC
GTTCCGTATTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAATACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTCCAGGAATGTCAAATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTTAAACTGCGTCTGGTGATCTATGAGCG
CGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACAGACAACG
GTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGAC
AAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGCATCATCCCTTACCGTGGTTCCTGGCTGGACTTCGA
ATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATTCTGCGCGCCCTGA
ACTACACCACAGAGCAGATCCTCGACCTGTTCTTTGAAAAAGTTATCTTTGAAATCCGTGATAACAAGCTGCAGATGGAA
CTGGTGCCGGAACGCCTGCGTGGTGAAACCGCATCTTTTGACATCGAAGCTAACGGTAAAGTGTACGTAGAAAAAGGCCG
CCGTATCACTGCGCGCCACATTCGCCAGCTGGAAAAAGACGACGTCAAACTGATCGAAGTCCCGGTTGAGTACATCGCAG
GTAAAGTGGTTGCTAAAGACTATATTGATGAGTCTACCGGCGAGCTGATCTGCGCAGCGAACATGGAGCTGAGTCTGGAG
CTGCTGGCTAAGCTGAGCCAATCTGGTCACAAGCGTATCGAAACGCTGTTCACCAACGATCTGGATCACGGCCCATATAT
CTCTGAAACCTTACGTGTCGACCCAACTAACGACCGTCTGAGCGCACTGGTAGAAATCTACCGCATGATGCGCCCTGGCG
AGCCGCCGACTCGTGAAGCAGCGGAAAGCCTGTTTGAGAACCTGTTCTTCTCCGAAGACCGCTATGACCTGTCTGCGGTT
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGAAGAAATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATTGA
TGTTATGAAAAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTCGATGATATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAAGCCGATTTCCGCAGCAGTGAAAGAGTTCTTCGG
TTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCG
GCCCAGGCGGTCTGACCCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCA
ATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGCACAGACTAACGAATACGGCTTCCT
TGAGACTCCGTATCGTAAAGTGACCGACGGTGTTGTAACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACT
ACGTTATCGCCCAGGCGAACTCCAACCTGGATGAAGAAGGCCACTTCGTAGAAGACCTGGTAACTTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCGACTCTGC
GCGCTGATAAGCCGCTGGTTGGTACTGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTAACTGCGGTAGCTAAACGT
GGTGGTGTCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGTGAAGCAGG
TATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATCAACCAGATGCCGTGTGTGTCTCTGG
GTGAACCGGTTGAACGTGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTTGGTCAGAACATG
CGCGTAGCGTTCATGCCGTGGAATGGTTACAACTTCGAAGACTCCATCCTCGTATCCGAGCGTGTTGTTCAGGAAGACCG
TTTCACCACCATCCACATTCAGGAACTGGCGTGTGTGTCCCGTGACACCAAGCTGGGGCCGGAAGAGATCACCGCTGACA
TCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTACATTGGTGCGGAAGTGACCGGTGGC
GACATTCTGGTTGGTAAGGTAACGCCGAAAGGTGAAACTCAGCTGACCCCAGAAGAAAAACTGCTGCGTGCGATCTTCGG
TGAGAAAGCCTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTATCCGGTACGGTTATCGACGTTCAGGTCT
TTACTCGCGATGGCGTAGAAAAAGACAAACGTGCGCTGGAAATCGAAGAAATGCAGCTCAAACAGGCGAAGAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCCGTGCTGTGCTGGTAGCCGGTGGCGTTGAAGCTGA
GAAGCTCGACAAACTGCCGCGCGATCGCTGGCTGGAGCTGGGCCTGACCGACGAAGAGAAACAAAATCAGCTGGAACAGC
TGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGAC
GATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCGGTTAAACGCCGTATCCAGCCTGGTGACAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTAATTTCTAAGATCAACCCGATCGAAGATATGCCTTACGATGAAAACGGTACGCCGG
TAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATCCTCGAAACCCACCTGGGTATGGCT
GCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAAACAGCAGCAAGAAGTCGCGAAACTGCGCGAATTCATCCAGCG
TGCGTACGATCTGGGCGCTGACGTTCGTCAGAAAGTTGACCTGAGTACCTTCAGCGATGAAGAAGTTATGCGTCTGGCTG
AAAACCTGCGCAAAGGTATGCCAATCGCAACGCCGGTGTTCGACGGTGCGAAAGAAGCAGAAATTAAAGAGCTGCTGAAA
CTTGGCGACCTGCCGACTTCCGGTCAGATCCGCCTGTACGATGGTCGCACTGGTGAACAGTTCGAGCGTCCGGTAACCGT
TGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAGATGCACGCGCGTTCCACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGTTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCA
TACGGCGCAGCATACACCTTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACTAAGATGTATAAAAA
CATCGTGGACGGCAACCATCAGATGGAGCCGGGCATGCCAGAATCCTTCAACGTATTGTTGAAAGAGATTCGTTCGCTGG
GTATCAACATCGAACTGGAAGACGAGTAA

>Rif|AE000516.2|gene708|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
GTGCTGGAAGGATGCATCTTGGCAGATTCCCGCCAGAGCAAAACAGCCGCTAGTCCTAGTCCGAGTCGCCCGCAAAGTTC
CTCGAATAACTCCGTACCCGGAGCGCCAAACCGGGTCTCCTTCGCTAAGCTGCGCGAACCACTTGAGGTTCCGGGACTCC
TTGACGTCCAGACCGATTCGTTCGAGTGGCTGATCGGTTCGCCGCGCTGGCGCGAATCCGCCGCCGAGCGGGGTGATGTC
AACCCAGTGGGTGGCCTGGAAGAGGTGCTCTACGAGCTGTCTCCGATCGAGGACTTCTCCGGGTCGATGTCGTTGTCGTT
CTCTGACCCTCGTTTCGACGATGTCAAGGCACCCGTCGACGAGTGCAAAGACAAGGACATGACGTACGCGGCTCCACTGT
TCGTCACCGCCGAGTTCATCAACAACAACACCGGTGAGATCAAGAGTCAGACGGTGTTCATGGGTGACTTCCCGATGATG
ACCGAGAAGGGCACGTTCATCATCAACGGGACCGAGCGTGTGGTGGTCAGCCAGCTGGTGCGGTCGCCCGGGGTGTACTT
CGACGAGACCATTGACAAGTCCACCGACAAGACGCTGCACAGCGTCAAGGTGATCCCGAGCCGCGGCGCGTGGCTCGAGT
TTGACGTCGACAAGCGCGACACCGTCGGCGTGCGCATCGACCGCAAACGCCGGCAACCGGTCACCGTGCTGCTCAAGGCG
CTGGGCTGGACCAGCGAGCAGATTGTCGAGCGGTTCGGGTTCTCCGAGATCATGCGATCGACGCTGGAGAAGGACAACAC
CGTCGGCACCGACGAGGCGCTGTTGGACATCTACCGCAAGCTGCGTCCGGGCGAGCCCCCGACCAAAGAGTCAGCGCAGA
CGCTGTTGGAAAACTTGTTCTTCAAGGAGAAGCGCTACGACCTGGCCCGCGTCGGTCGCTATAAGGTCAACAAGAAGCTC
GGGCTGCATGTCGGCGAGCCCATCACGTCGTCGACGCTGACCGAAGAAGACGTCGTGGCCACCATCGAATATCTGGTCCG
CTTGCACGAGGGTCAGACCACGATGACCGTTCCGGGCGGCGTCGAGGTGCCGGTGGAAACCGACGACATCGACCACTTCG
GCAACCGCCGCCTGCGTACGGTCGGCGAGCTGATCCAAAACCAGATCCGGGTCGGCATGTCGCGGATGGAGCGGGTGGTC
CGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGAT
CAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC
GACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTAC
GGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAA
CCCGTTCGGGTTCATCGAAACGCCGTACCGCAAGGTGGTCGACGGCGTGGTTAGCGACGAGATCGTGTACCTGACCGCCG
ACGAGGAGGACCGCCACGTGGTGGCACAGGCCAATTCGCCGATCGATGCGGACGGTCGCTTCGTCGAGCCGCGCGTGCTG
GTCCGCCGCAAGGCGGGCGAGGTGGAGTACGTGCCCTCGTCTGAGGTGGACTACATGGACGTCTCGCCCCGCCAGATGGT
GTCGGTGGCCACCGCGATGATTCCCTTCCTGGAGCACGACGACGCCAACCGTGCCCTCATGGGGGCAAACATGCAGCGCC
AGGCGGTGCCGCTGGTCCGTAGCGAGGCCCCGCTGGTGGGCACCGGGATGGAGCTGCGCGCGGCGATCGACGCCGGCGAC
GTCGTCGTCGCCGAAGAAAGCGGCGTCATCGAGGAGGTGTCGGCCGACTACATCACTGTGATGCACGACAACGGCACCCG
GCGTACCTACCGGATGCGCAAGTTTGCCCGGTCCAACCACGGCACTTGCGCCAACCAGTGCCCCATCGTGGACGCGGGCG
ACCGAGTCGAGGCCGGTCAGGTGATCGCCGACGGTCCCTGTACTGACGACGGCGAGATGGCGCTGGGCAAGAACCTGCTG
GTGGCCATCATGCCGTGGGAGGGCCACAACTACGAGGACGCGATCATCCTGTCCAACCGCCTGGTCGAAGAGGACGTGCT
CACCTCGATCCACATCGAGGAGCATGAGATCGATGCTCGCGACACCAAGCTGGGTGCGGAGGAGATCACCCGCGACATCC
CGAACATCTCCGACGAGGTGCTCGCCGACCTGGATGAGCGGGGCATCGTGCGCATCGGTGCCGAGGTTCGCGACGGGGAC
ATCCTGGTCGGCAAGGTCACCCCGAAGGGTGAGACCGAGCTGACGCCGGAGGAGCGGCTGCTGCGTGCCATCTTCGGTGA
GAAGGCCCGCGAGGTGCGCGACACTTCGCTGAAGGTGCCGCACGGCGAATCCGGCAAGGTGATCGGCATTCGGGTGTTTT
CCCGCGAGGACGAGGACGAGTTGCCGGCCGGTGTCAACGAGCTGGTGCGTGTGTATGTGGCTCAGAAACGCAAGATCTCC
GACGGTGACAAGCTGGCCGGCCGGCACGGCAACAAGGGCGTGATCGGCAAGATCCTGCCGGTTGAGGACATGCCGTTCCT
TGCCGACGGCACCCCGGTGGACATTATTTTGAACACCCACGGCGTGCCGCGACGGATGAACATCGGCCAGATTTTGGAGA
CCCACCTGGGTTGGTGTGCCCACAGCGGCTGGAAGGTCGACGCCGCCAAGGGGGTTCCGGACTGGGCCGCCAGGCTGCCC
GACGAACTGCTCGAGGCGCAGCCGAACGCCATTGTGTCGACGCCGGTGTTCGACGGCGCCCAGGAGGCCGAGCTGCAGGG
CCTGTTGTCGTGCACGCTGCCCAACCGCGACGGTGACGTGCTGGTCGACGCCGACGGCAAGGCCATGCTCTTCGACGGGC
GCAGCGGCGAGCCGTTCCCGTACCCGGTCACGGTTGGCTACATGTACATCATGAAGCTGCACCACCTGGTGGACGACAAG
ATCCACGCCCGCTCCACCGGGCCGTACTCGATGATCACCCAGCAGCCGCTGGGCGGTAAGGCGCAGTTCGGTGGCCAGCG
GTTCGGGGAGATGGAGTGCTGGGCCATGCAGGCCTACGGTGCTGCCTACACCCTGCAGGAGCTGTTGACCATCAAGTCCG
ATGACACCGTCGGCCGCGTCAAGGTGTACGAGGCGATCGTCAAGGGTGAGAACATCCCGGAGCCGGGCATCCCCGAGTCG
TTCAAGGTGCTGCTCAAAGAACTGCAGTCGCTGTGCCTCAACGTCGAGGTGCTATCGAGTGACGGTGCGGCGATCGAACT
GCGCGAAGGTGAGGACGAGGACCTGGAGCGGGCCGCGGCCAACCTGGGAATCAATCTGTCCCGCAACGAATCCGCAAGTG
TCGAGGATCTTGCGTAA

>Rif|CP000647.1|gene4402|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGGTCGACTTGTCAGCGAGCTGAGGAACCCTATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGG
TAAACGTCCACAAGTTCTGGATGTGCCATATCTCCTTTCTATCCAGCTTGACTCGTTCCAGAAGTTTATCGAGCAAGATC
CTGAAGGGCAGTATGGTCTGGAAGCTGCTTTCCGTTCCGTATTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAA
TACGTCAGCTACCGTCTGGGCGAACCGGTTTTTGACGTTAAAGAATGTCAGATCCGTGGCGTGACTTATTCTGCACCGCT
GCGCGTAAAACTGCGTCTGGTGATCTACGAGCGCGAAGCGCCAGAAGGCACCGTCAAAGACATTAAAGAACAAGAAGTCT
ACATGGGCGAAATTCCGCTCATGACCGACAACGGTACCTTTGTTATCAACGGTACCGAGCGTGTTATCGTTTCTCAGCTG
CACCGTAGCCCGGGCGTCTTCTTTGACAGTGACAAAGGTAAGACCCACTCCTCCGGTAAGGTTCTGTATAACGCACGTAT
CATCCCTTACCGCGGTTCCTGGCTGGACTTCGAATTCGACCCGAAAGACAACCTGTTCGTTCGTATCGACCGTCGTCGTA
AGCTGCCGGCTACCATCATCCTGCGCGCGCTGAATTACACCACTGAGCAGATCCTTGACCTGTTCTTCGAAAAAGTGGTC
TTTGAAATTCGCGACAACAAGCTGCAGATGGAGCTGATTCCGGAGCGTCTGCGCGGTGAAACTGCCTCCTTCGATATCGA
AGCCAACGGCAAAGTGTACGTTGAGAAAGGCCGTCGCATCACGGCTCGTCATATCCGTCAGCTGGAAAAAGACGATATCA
AGCATATCGAAGTGCCGGTTGAATATATCGCGGGCAAAGTGGCGGCTAAAGACTATATCGATGAAGCGACTGGCGAACTG
ATCTGCCCGGCGAACATGGAGCTGAGCCTGGATCTGCTGGCTAAGCTGAGCCAGTCTGGCCACAAGCGTATCGAAACGCT
GTTCACCAACGATCTGGACCACGGCCCGTACATCTCTGAAACGGTACGCGTCGACCCGACTAACGATCGTCTGAGCGCGC
TGGTAGAAATCTACCGCATGATGCGCCCTGGCGAGCCGCCGACTCGTGAAGCCGCTGAAAGTCTGTTTGAGAACCTGTTC
TTCTCTGAAGACCGCTACGATCTGTCCGCGGTTGGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGACGAAATCGAAGG
TTCCGGTATCCTGAGCAAAGACGACATCATCGAAGTGATGAAGAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTGG
ACGATATCGACCACCTCGGCAACCGTCGTATCCGTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTA
CGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCTCTTGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAA
GCCGATTTCCGCAGCAGTGAAAGAGTTCTTTGGTTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTG
AGATTACGCACAAACGTCGTATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAGCGCGCAGGCTTCGAAGTTCGAGAC
GTACACCCGACCCACTACGGTCGCGTATGTCCGATCGAAACGCCTGAAGGTCCAAACATCGGTCTGATTAACTCCCTGTC
CGTGTACGCGCAGACCAACGAATATGGCTTCCTTGAGACGCCGTATCGTAAAGTGACCGACGGTGTGGTTACTGACGAAA
TTCACTACCTGTCTGCTATCGAAGAAGGCAACTACGTTATCGCTCAGGCGAACTCCAACCTGGATGAAAACGGCCACTTC
GTAGAAGATCTGGTTACCTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTATC
CACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTG
CGAACATGCAACGTCAGGCGGTTCCGACTCTGCGCGCTGATAAGCCGCTGGTTGGTACCGGTATGGAACGTGCTGTTGCC
GTTGACTCCGGTGTTACTGCCGTGGCTAAACGTGGCGGTACCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGT
TAACGAAGACGAGATGTACCCGGGCGAAGCAGGTATCGACATCTATAACCTGACCAAGTACACCCGTTCTAACCAGAACA
CCTGCATCAACCAGATGCCTTGCGTGTCCCTGGGCGAACCTATTGAGCGCGGCGACGTGCTGGCAGACGGCCCGTCCACC
GACCTCGGTGAGCTGGCGCTGGGTCAGAACATGCGTGTAGCGTTCATGCCGTGGAACGGTTACAACTTCGAAGACTCCAT
CCTCGTTTCCGAGCGTGTTGTCCAGGAAGACCGTTTCACCACTATCCACATTCAGGAACTGGCGTGCGTGTCCCGTGACA
CCAAGCTGGGGCCGGAAGAGATCACCGCTGACATCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGT
ATCGTTTATATCGGTGCGGAAGTGACCGGCGGCGACATTCTGGTTGGTAAGGTAACGCCGAAAGGTGAAACCCAGCTGAC
GCCGGAAGAGAAACTGCTGCGCGCGATCTTCGGTGAGAAAGCGTCTGATGTTAAAGACTCTTCTCTGCGCGTACCGAACG
GTGTCTCTGGTACCGTTATCGACGTTCAGGTCTTTACCCGTGACGGCGTAGAAAAAGACAAACGTGCTCTGGAAATCGAA
GAGATGCAGCTGAAGCAGGCCAAAAAAGACCTGTCTGAAGAACTGCAGATCCTCGAAGCCGGTCTGTTCAGTCGTATCTA
CGCGGTGCTGGTCTCCGGTGGCGTTGAAGCTGAGAAGCTCGACAAGCTGCCTCGCGATCGCTGGCTGGAACTGGGCCTGA
CCGACGAAGAGAAACAAAATCAGCTGGAACAGCTGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAAAAACTC
GAAGCGAAACGCCGTAAAATCACCCAAGGCGACGATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCCGT
TAAACGCCGTATCCAGCCTGGTGATAAGATGGCAGGTCGTCACGGTAACAAGGGTGTTATCTCTAAGATCAACCCGATCG
AAGATATGCCGCACGATGCTAACGGTACGCCGGTAGATATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATC
GGTCAGATCCTTGAAACTCACCTGGGTATGGCTGCAAAAGGCATCGGCGATAAGATCAACGCCATGCTGAAGCAGCAGCA
GGAAGTCGCGAAACTGCGCGAATTCATCCAGCGTGCTTACGATCTGGGCGCTGACGTTCGCCAGAAAGTTGACCTGAATA
CCTTCAGCGATGAAGAAGTTCTGCGTCTGGCTGAAAACCTGCGTAAAGGCATGCCGATCGCAACGCCGGTATTCGACGGT
GCGAAAGAAGCTGAAATCAAAGAGCTGCTGCAGCTGGGCGACCTGCCGACTTCCGGTCAGATCACCCTGTTTGATGGCCG
CACCGGTGAACAGTTCGAACGTCCGGTAACCGTGGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAAA
TGCACGCTCGTTCCACCGGTTCTTACAGCCTGGTTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGC
TTCGGTGAGATGGAAGTGTGGGCGCTGGAAGCATACGGCGCGGCCTACACCCTGCAGGAAATGCTCACCGTTAAGTCTGA
TGACGTGAACGGTCGTACCAAGATGTATAAAAACATCGTGGACGGCAATCACCAGATGGAACCGGGCATGCCGGAATCCT
TCAACGTACTGTTGAAAGAAATTCGCTCGCTGGGCATCAACATCGAACTGGAAGACGAGTAA

>Rif|NC_011035.1.6448762|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGAACTATTCGTTTACCGAGAAAAAACGTATCCGTAAGAGTTTTGCAAAGCGGGAAAATGTTTTGGAAGTTCCTTTTCT
ACTGGCAACCCAAATTGATTCTTATGCGAAATTTTTGCAGCTGGAAAATGCTTTTGACAAACGTACCGATGACGGTCTGC
AAGCGGCATTTAATTCTATTTTCCCGATTGTGAGCCACAACGGTTATGCTCGTCTGGAGTTTGTATATTACACGCTGGGC
GAGCCTTTGTTCGATATCCCTGAATGTCAATTGCGCGGAATCACTTATGCTGCCCCTCTGCGCGCGCGTATCCGTTTGGT
GATTTTGGATAAGGAAGCGTCTAAACCGACGGTAAAAGAAGTTCGTGAAAACGAAGTGTATATGGGCGAAATTCCGTTGA
TGACCCCGAGCGGTTCTTTTGTGATTAACGGCACAGAGCGTGTGATTGTTTCCCAGTTGCACCGTTCGCCCGGTGTGTTC
TTCGAGCATGACAAAGGTAAGACACACTCTTCCGGCAAATTGTTATTCTCCGCCCGCATCATTCCCTACCGTGGTTCATG
GTTGGATTTTGAATTTGATCCGAAAGATTTGCTGTATTTCCGTATCGACCGCCGCCGTAAAATGCCGGTAACGATTTTGT
TGAAGGCTTTGGGCTACAACAATGAGCAAATCTTGGATATTTTCTACGACAAAGAAACGTTTTATTTGTCTTCAAACGGT
GTTCAAACCGATTTGGTCGCAGGCCGTCTGAAAGGCGAAACTGCCAAGGTCGATATCTTGGATAAAGAAGGCAATGTATT
GGTTGCCAAAGGTAAGCGCATTACTGCGAAAAATATCCGTGATATTACCAATGCAGGCCTGACCCGTTTGGATGTAGAAC
AGGAAAGCCTGCTGGGCAAAGCATTGGCTGCCGATTTGATTGATTCGGAAACCGGCGAGGTATTGGCTTCTGCCAATGAT
GAAATTACAGAAGAGTTGTTGGCCAAATTTGATATTAACGGCGTAAAAGAAATTACGACCCTTTACATCAATGAGTTGGA
TCAGGGTGCTTATATTTCCAATACCTTGCGCACGGATGAGACTGCCGGCCGGCAGGCGGCGCGTGTTGCGATTTACCGTA
TGATGCGTCCGGGCGAACCGCCCACCGAAGAGGCGGTCGAGCAATTGTTTAACCGCTTGTTCTTCAGTGAAGACAGCTAC
GATTTGTCCCGCGTAGGCCGTATGAAATTTAATACGCGCACATACGAACAAAAACTGTCCGAAGCCCAACAAAACTCTTG
GTACGGCCGCCTGTTGAACGAGACGTTTGCCGGTGCTGCCGACAAAGGCGGTTATGTCCTGAGCGTCGAAGATATTGTCG
CCTCGATTGCGACTTTGGTCGAGTTGCGTAACGGCCATGGCGAAGTGGACGATATCGATCACTTGGGCAACCGTCGAGTA
CGGTCGGTAGGCGAGCTGACTGAAAACCAATTCCGCAGCGGTTTGGCTCGTGTGGAACGTGCCGTAAAAGAACGTTTGAA
TCAGGCGGAATCAGAAAACTTGATGCCGCACGACTTGATTAATGCGAAACCCGTTTCTGCCGCCATCAAAGAATTCTTCG
GCTCCAGCCAATTGAGTCAGTTTATGGATCAGACCAATCCCTTGTCTGAAGTAACCCATAAACGCCGTGTATCTGCATTG
GGCCCGGGCGGTTTGACCCGCGAACGTGCCGGCTTCGAAGTGCGGGACGTGCATCCGACCCACTATGGACGTGTATGTCC
TATTGAAACGCCTGAAGGTCCGAACATCGGTTTGATCAACTCATTGTCTGTTTACGCGCGCACCAATGATTACGGTTTCT
TGGAAACGCCTTACCGCCGCGTTATTGACGGCAAAGTAACCGAGGAAATTGATTACTTGTCTGCCATCGAAGAAGGCCGC
TATGTGATTGCACAGGCGAATGCCGATTTGGATTCAGACGGCAATCTGATTGGCGATTTGGTTACCTGTCGTGAAAAAGG
CGAAACCATTATGGCAACGCCCGACCGCGTCCAATATATGGACGTGGCAACCGGTCAGGTGGTATCCGTTGCGGCATCCC
TGATTCCGTTCTTGGAACACGATGACGCGAACCGCGCATTGATGGGTGCCAACATGCAACGTCAGGCAGTGCCTTGTCTG
CGTCCTGAAAAACCGATGGTCGGTACCGGTATCGAGCGTTCCGTTGCCGTTGACTCTGCTACTGCAATCGTTGCCCGCCG
AGGCGGCGTGGTCGAGTATGTCGATGCCAACCGCGTTGTGATCCGTGTCCATGACGACGAAGCGACTGCCGGCGAAGTGG
GTGTCGATATTTACAATTTGGTTAAATTCACCCGTTCCAATCAATCTACCAACATCAACCAACGTCCGGCTGTCAAAGCA
GGCGATGTTTTGCAACGCGGCGATTTGGTGGCCGACGGCGCGTCCACCGATTTGGGCGAATTGGCTTTGGGTCAAAATAT
GACCATCGCCTTCATGCCGTGGAACGGTTACAACTACGAAGACTCGATTCTGATTTCCGAAAAAGTGGCTGCGGACGACC
GCTATACTTCGATTCACATTGAGGAATTGAATGTCGTTGCCCGCGATACCAAGCTGGGTGCGGAAGACATTACCCGCGAT
ATTCCGAACTTGTCCGAGCGTATGCAAAACCGTTTGGACGAATCCGGTATCGTTTACATCGGTGCGGAAGTAGAAGCCGG
CGATGTGTTGGTAGGCAAGGTAACGCCTAAAGGCGAAACCCAGCTGACGCCGGAAGAAAAACTGCTGCGCGCCATCTTCG
GCGAAAAAGCGTCTGACGTAAAAGATACTTCATTGCGTATGCCTACCGGTATGAGCGGTACGGTTATCGACGTTCAAGTC
TTTACCCGCGAAGGCATCCAACGCGACAAACGCGCCCAATCCATTATCGATTCCGAATTGAAACGCTACCGTTTGGATTT
GAACGACCAATTGCGTATTTTCGACAACGACGCATTCGACCGTATCGAGCGTATGATTGTCGGTCAGAAAGCCAACGGCG
GTCCGATGAAGCTGGCCAAAGGCAGCGAAATCACGACCGAATATCTGGCGGGTCTGCCGAGCAGGCACGATTGGTTTGAT
ATCCGTTTGACCGATGAAGATTTGGCCAAGCAGTTGGAACTGATTAAATTGAGCCTGCAACAAAAACGCGAAGAAGCGGA
TGAGTTGTATGAGATCAAGAAGAAAAAACTGACCCAAGGCGACGAGCTGCAACCCGGCGTACAAAAAATGGTGAAAGTCT
TTATCGCCATCAAACGCCGTCTGCAAGCCGGTGACAAAATGGCGGGCCGCCACGGTAATAAAGGTGTGGTATCTCGCATT
CTGCCTGTGGAAGACATGCCGTACATGGCGGACGGCCGTCCTGTGGACATCGTACTGAACCCGTTGGGCGTACCTTCCCG
TATGAACATCGGTCAGATTTTGGAAGTTCACTTGGGTTGGGCGGCAAAAGGTATCGGCGAGCGCATCGACCGTATGCTGA
AAGAGCGACGCAAAGCCGGCGAGCTGCGCGAGTTCTTGAACAAACTCTACAACGGCAGCGGTAAGAAAGAAGATTTGGAC
AGCCTGACTGATGAAGAAATCATCGAATTGGCTTCCAATCTGCGTAAAGGTGCATCTTTCGCCTCTCCTGTATTCGACGG
TGCGAAAGAGTCTGAAATCCGCGAAATGTTGAACTTGGCTTACCCAAGCGAAGATCCTGAGGTTGAGAAACTGGGCTTCA
ACGACAGTAAAACTCAAATCACGCTGTATGACGGCCGTTCAGGCGAAGCATTTGACCGCAAGGTTACAGTCGGTGTGATG
CACTATCTGAAACTGCACCACTTGGTTGACGAAAAAATGCACGCGCGTTCTACCGGCCCGTACAGTCTGGTTACTCAACA
ACCTCTGGGCGGTAAAGCTCAGTTTGGCGGCCAACGTTTCGGTGAGATGGAGGTTTGGGCATTGGAAGCATACGGCGCGG
CATACACGCTGCAAGAGATGCTGACTGTGAAGTCTGACGACGTGAACGGCCGTACCAAAATGTACGAAAACATCGTCAAA
GGCGAACACAAAATCGATGCCGGTATGCCCGAGTCCTTCAACGTATTGGTCAAAGAGATTCGCTCACTGGGTTTGGATAT
CGATTTGGAACGCTACTGA

>Rif|FN543093.2|gene314|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGACAGAGTGGGTCGACTTGTCAGCGAGCTGAGGAACCCTATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAA
GGATTTTGGTAAACGTCCACAAGTTCTGGATGTTCCCTATCTCCTTTCTATCCAGCTTGACTCGTTCCAGAAATTTATCG
AGCAAGATCCTGAGGGTCAGTACGGTCTGGAAGCAGCTTTCCGCTCCGTATTCCCGATTCAGAGCTACAGCGGCAATTCG
GAACTGCAATACGTCAGCTACCGTCTTGGCGAACCGGTGTTTGATGTTAAAGAATGCCAGATCCGTGGCGTGACCTATTC
GGCACCGCTGCGCGTTAAGCTGCGTCTGGTGATCTACGAGCGCGAAGCGCCGGAAGGCACCGTTAAAGACATCAAAGAGC
AAGAAGTTTACATGGGCGAAATTCCGCTCATGACCGATAACGGTACCTTTGTTATCAACGGTACTGAGCGCGTTATCGTT
TCTCAGCTGCACCGTAGCCCGGGCGTGTTCTTTGACAGCGACAAGGGTAAAACTCACTCCTCTGGTAAGGTGCTGTATAA
CGCACGCATCATTCCTTACCGTGGCTCCTGGCTGGACTTTGAGTTCGATCCGAAAGACAACCTGTTTGTCCGTATCGACC
GTCGTCGTAAGCTGCCGGCAACGATCATCCTGCGCGCGCTGGATTACACCACTGAGCAGATCCTTGACCTGTTCTTTGAG
AAAGTGGTTTTCGAAATCCGCGACAACAAGCTGCAGATGGAGCTGATTCCGGAACGCCTGCGTGGTGAGACCGCCTCTTT
TGATATCGAAGCAAACGGCAAAATTTACGTAGAAAAAGGCCGTCGTATCACTGCGCGTCACATCCGCCAGCTCGAAAAAG
ACGAAATCAAACTCATCGAAGTTCCGGTGGAATACATCGCGGGCAAAGTGGCGGCGAAAGATTACGTGGATGCTTCCACT
GGCGAGCTGATCTGCCCGGCCAACATGGAGCTGTCCCTGGATCTGCTGGCGAAACTGAGCCAGTCTGGTCACAAACGTAT
CGAGACGCTGTTCACCAACGACCTCGATCACGGCCCGTACATGTCTGAGACCGTACGCGTCGACCCGACGACCGATCGCC
TGAGCGCGCTGGTTGAAATCTACCGCATGATGCGTCCTGGCGAGCCGCCGACGCGTGAAGCGGCGGAAAGCCTGTTTGAG
AACCTGTTCTTCTCTGAAGATCGTTACGATCTGTCTGCGGTTGGCCGCATGAAGTTCAACCGTTCTCTGCTGCGTGATGA
GATCGAAGGTTCCGGTATCCTGAGCAAAGCTGACATCATCGACGTGATGAAGAAGCTCATCGATATCCGTAACGGTAAAG
GCGAAGTGGATGATATCGACCACCTCGGCAACCGTCGTATCCGTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGTGTT
GGTCTGGTGCGTGTAGAGCGTGCGGTAAAAGAACGTCTGTCTCTGGGCGATCTGGATACCCTGATGCCGCAGGATATGAT
CAACGCCAAGCCTATCTCCGCTGCGGTAAAAGAGTTCTTCGGCTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACC
CGCTGTCTGAGATTACGCACAAGCGTCGTATCTCTGCACTGGGCCCGGGCGGTCTGACGCGTGAGCGCGCAGGCTTCGAA
GTTCGAGACGTACACCCGACCCACTACGGTCGCGTATGTCCTATCGAAACGCCGGAAGGTCCGAACATCGGTCTGATCAA
TTCCCTGTCCGTGTACGCACAGACTAACGAATATGGCTTCCTTGAGACGCCGTATCGTAAAGTTACCGACGGTGTGGTTA
CCGATGAAATTCATTACCTCTCCGCTATCGAAGAAGGTAACTACGTTATCGCTCAGGCGAACACCAACCTGACCGAAGAA
GGCCGCTTCGCCGACGATTTGGTCACCTGCCGCAGCAAAGGCGAATCCAGCCTCTTCAGCGCAGACCAGGTTGACTATAT
GGACGTTTCCACCCAGCAGGTGGTTTCCGTCGGTGCGTCCCTAATCCCGTTCCTTGAACACGATGACGCCAACCGTGCAT
TGATGGGTGCGAACATGCAACGTCAGGCGGTTCCGACTCTGCGCGCTGATAAGCCGCTGGTTGGTACCGGTATGGAACGT
GCTGTTGCCGTTGACTCCGGCGTAACCGCCGTGGCGAAACGTGGCGGTACCGTTCAGTACGTGGATGCCTCCCGTATCGT
TATCAAAGTTAACGAAGACGAGATGTACCCGGGCGAAGCAGGTATCGACATCTATAACCTGACTAAATACACCCGTTCTA
ACCAGAACACCTGCATCAACCAGATGCCGTGCGTGTCTCTGAATGAACCGGTTGAGCGCGGCGACGTGCTGGCAGACGGT
CCGTCCACCGACCTCGGTGAACTGGCGCTCGGTCAGAACATGCGCGTAGCGTTCATGCCGTGGAACGGCTACAACTTCGA
AGACTCCATCCTCGTTTCCGAGCGTGTGGTTCAGGAAGACCGTTTCACTACGATTCACATCCAGGAACTGGCGTGCGTAT
CTCGCGATACCAAGCTGGGGCCGGAAGAGATCACCGCTGACATCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGAT
GAATCCGGTATCGTCTACATCGGCGCGGAAGTGACCGGCGGCGACATTCTGGTGGGCAAGGTAACGCCGAAAGGTGAAAC
CCAGCTGACGCCGGAAGAGAAACTGCTGCGTGCTATCTTCGGTGAGAAAGCGTCTGACGTTAAAGACTCTTCTCTGCGTG
TGCCGAACGGTGTTTCCGGTACGGTTATCGACGTTCAGGTCTTTACCCGCGATGGCGTGGAAAAAGACAAACGTGCGCTG
GAAATCGAAGAAATGCAGCTCAAGCAGGCCAAAAAAGACCTGTCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAG
CCGTATTCGCGCTGTCCTGATCGCAGGCGGCGTCGAAGCTGAGAAGCTCGACAAGCTGCCGCGCGACCGCTGGCTGGAAC
TCGGCCTGACCGACGAAGAGAAACAGAATCAGCTGGAACAGCTGGCTGAGCAGTACGACGAACTGAAGCACGAGTTTGAG
AAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGACGATCTGGCGCCGGGCGTGCTGAAAATCGTTAAGGTGTA
TCTGGCCGTTAAACGTCAGATCCAGCCGGGCGATAAAATGGCAGGCCGCCACGGTAACAAAGGTGTTATCTCCAAGATCA
ACCCGATCGAAGATATGCCTTACGATGAAAACGGCACGCCGGTAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGT
ATGAACATCGGTCAGATCCTGGAAACCCACCTGGGTATGGCGGCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAA
GCGTCAGGAAGAAGTCGCGAAACTGCGCGAATTCATCCAGAAAGCTTACGACCTCGGTCAGGATGTTCGTCAGAAAGTTG
ACCTGAACACCTTCAGCGACGAAGAAGTACTGCGTCTGGCTGAAAACCTGCGTAAAGGTATGCCGCTCGCCACGCCGGTA
TTCGACGGCGCGAAAGAAGCTGAGATTAAAGAGCTGCTGCAGCTGGGCGACCTGCCGACTTCCGGTCAGATCACCCTGTT
CGACGGCCGTACGGGTGAACAGTTCGAGCGTCCGGTAACCGTAGGTTACATGTACATGCTGAAACTGAACCACCTGGTCG
ACGACAAGATGCACGCTCGTTCCACCGGTTCTTACAGCCTCGTTACTCAGCAGCCGCTGGGTGGTAAGGCGCAGTTCGGT
GGTCAGCGCTTCGGTGAGATGGAAGTATGGGCGCTGGAAGCTTATGGCGCCGCCTATACCCTGCAGGAAATGCTTACCGT
TAAGTCTGATGACGTGAACGGCCGTACCAAGATGTATAAGAACATCGTGGATGGCAACCATCAGATGGAACCGGGCATGC
CGGAATCGTTCAACGTACTGTTGAAAGAGATTCGTTCGCTGGGCATCAACATCGAACTGGAAGACGAGTAA

>Rif|NC_002745.1123305|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAACCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAACGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGAACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATCGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>Rif|AE016830.1|gene3155|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
GTGAAGAGCTTGGCTGGACACGTAGTAAAATACGGAAAGCATCGCGAACGTAGAAGTTTCGCACGTATCAGTGAAGTATT
GGAATTACCAAATTTAATTGAAATCCAAACAGACTCTTATCAATGGTTTTTAGATGAGGGACTTCGTGAAATGTTTGAAG
ACATTTTACCAATTGATGATTTCCAAGGAAACTTATCCTTAGAATTTGTTGACTATGAATTAAAAGAACCAAAGTACACA
GTAGAAGAAGCCCGCGCACATGATGCCAACTATTCTGCGCCATTACATGTAACATTACGTTTAACCAACCGTGAAACAGG
TGAAATTAAATCCCAAGAAGTATTCTTCGGCGATTTCCCATTAATGACAGAAATGGGTACCTTCATCATCAACGGGGCAG
AACGTGTTATCGTTTCCCAATTAGTTCGTTCTCCAGGTGTTTATTTCCATGGAAAAGTGGACAAAAACGGCAAAGAAGGT
TTTGGCTCAACAGTCATTCCTAACCGTGGTGCATGGTTAGAAATGGAAACAGATGCGAAAGACATTTCTTATGTTCGGAT
TGACCGCACACGTAAAATTCCTTTAACTGTGTTAGTTCGTGCTTTAGGTTTCGGTTCAGATGATACCATCTTCGAAATTT
TCGGCGACAGCGAAAGCTTACGCAACACAATTGAAAAAGATTTACACAAAAATGCAAGTGATTCTCGTACAGAAGAAGGC
TTGAAAGACATTTATGAACGTCTTCGCCCAGGCGAACCAAAAACAGCAGATAGCTCACGTAGCTTGTTAACTGCACGTTT
CTTTGATCCAAAACGTTATGATTTGGCAAACGTTGGTCGCTACAAAGTTAACAAAAAATTAGACTTAAAAACACGTCTAT
TAAACTTAACCTTAGCGGAAACGCTAGTTGATCCAGAAACTGGTGAAATCATTGTCGAAAAAGGCACGGTTTTAACACAC
CAAATCATGGAAACATTAGGCGAATACATTGACAACGGCTTAAACAGCGTAACTTACTATCCAAGTGAAGATGCTGTAGT
AACTGAACCAATGACAATCCAAGTGATTCAAGTTCTTTCACCAAAAGATCCTGAACGTATCGTAAATGTGATTGGTAACG
GCTATCCAGACGACAGCGTAAAAACAGTTCGTCCAGCAGATATCGTTGCTTCAATGAGCTACTTCTTCAACTTAATGGAA
GATATCGGCAATGTCGATGACATCGACCACTTAGGTAATCGTCGTATCCGTTCAGTAGGTGAATTATTACAAAACCAATT
CCGTATTGGCTTAGCCCGTATGGAACGTGTGGTTCGTGAAAGAATGTCTATTCAAGACACAGAAACATTGACACCACAAC
AATTAATCAACATCCGTCCAGTGGTAGCAAGTATCAAAGAATTCTTTGGTTCTTCACAGTTATCACAGTTCATGGACCAA
ACAAACCCATTAGGTGAGTTAACCCATAAACGTCGTCTATCAGCCTTAGGGCCTGGTGGTTTGACTCGTGACCGTGCCGG
TTATGAAGTTCGTGACGTTCACTACTCTCACTATGGTCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAATATCGGGT
TGATCAATAGTTTATCTAGTTACGCAAAAGTGAATAAATTTGGTTTCATCGAAACGCCTTATCGCCGTGTTGATCGTGCG
ACAGGCCGTGTTACTGATCAAGTAGATTACTTAACAGCAGACATCGAAGACCATTATATCGTAGCGCAAGCGAACTCACT
TTTAAATGAAGATGGCACATTTGCCAATGATGTTGTTATGGCGCGTCTACAAAGTGAAAACTTAGAAGTTGCCGTAGACA
AAGTTGACTACATGGACGTTTCACCAAAACAAGTAGTCGCAGTCGCAACAGCATGTATTCCTTTCTTAGAAAACGATGAC
TCCAACCGTGCCTTGATGGGTGCCAACATGCAGCGTCAAGCGGTGCCGTTAATTCAACCACGCTCTCCGTGGGTAGGTAC
AGGGATGGAATATAAATCAGCCCATGACTCAGGTGCTGCTTTACTATGTAAACATGACGGTGTCGTAGAATTCGTCGATG
CAAAAGAAATTCGCGTTCGTCGCGACAATGGCGCATTAGACAAATATATGGTTACTAAATTCCGTCGTTCAAATTCAGGA
ACAAGCTACAACCAACGCCCAATTGTTCACTTAGGTGAAAAAGTTGAAAAAGGCGATACTTTAGCGGATGGACCTTCTAT
GGAAGAAGGCGAAATGGCTTTAGGGCAAAACGTCTTAGTTGCCTTCATGACATGGGAAGGTTACAACTACGAGGATGCCA
TTATCATGAGCCGTCGTTTAGTTAAAGACGATGTTTACACTTCTGTGCATATTGAAGAATATGAATCAGAAGCACGTGAT
ACAAAATTAGGACCTGAAGAAATTACCCGTGAAATTCCAAACGTTGGGGAAGACGCATTGAAAGACTTAGACGAAATGGG
GATTATCCGCATTGGTGCTGAAGTTCAAGATGGCGACTTACTAGTTGGTAAAGTCACACCTAAAGGGGTCACAGAATTAT
CTGCAGAAGAACGTTTATTACACGCAATCTTCGGGGAAAAAGCCCGCGAAGTTCGTGACACGTCTCTCCGTGTACCTCAC
GGTGGCGGCGGTATCGTTCACGATGTGAAAATCTTTACTCGTGAAGCTGGCGATGAATTATCACCAGGTGTCAACATGTT
AGTTCGTGTCTATATCGTTCAAAAACGTAAAATTCACGAAGGAGATAAAATGGCGGGACGTCACGGAAATAAAGGGGTTG
TTTCCCGTATTATGCCGGAAGAAGATATGCCATTCTTACCTGACGGAACACCTGTTGATATCATGTTGAACCCATTAGGG
GTACCTTCTCGTATGAATATCGGACAAGTACTTGAATTACACTTAGGTATGGCTGCTCGCCAATTAGGCATTCACGTCGC
AACACCTGTTTTCGATGGGGCAACCGATGAAGACGTTTGGGAAACTGTTCGTGAAGCTGGTATGGCTAGCGATGCTAAAA
CAGTTCTTTACGATGGACGTACAGGTGAACCATTTGATAACCGTATTTCCGTTGGTGTCATGTATATGATTAAATTAGCC
CACATGGTTGATGACAAATTGCATGCTCGTTCAATCGGACCTTACTCTCTTGTTACGCAACAACCGTTGGGTGGTAAAGC
TCAATTCGGTGGACAACGTTTCGGGGAAATGGAAGTTTGGGCACTGGAAGCTTACGGTGCTGCTTACACATTACAAGAAA
TCTTAACTTACAAATCTGATGACGTTGTCGGACGTGTGAAAACATACGAAGCCATCGTTAAAGGTGAACCAATTCCAAAA
CCAGGTGTGCCTGAATCATTCCGAGTATTAGTGAAAGAATTACAATCACTTGGTTTAGACATGCGTGTCTTGGACATTGA
GGAAGCTGAGATTGAGTTACGCGATATGGACGATGACGATGATGATTTAATCACCGTTGACGCACTAACCAAATTTGCGG
AACAACAATCAGCGAAACAGCTGGAAAAAGAAGCAGAATCAGTCGTGAAAGAAGAAGCACAAGACGTTGTTCAAGAAATT
GAAACAGCCGAAGACAGAGACTAA

>Rif|NC_002695.1.914942|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTACCTTATCT
CCTTTCTATCCAGCTTGACTCGTTTCAGAAATTTATCGAGCAAGATCCTGAAGGGCAGTATGGTCTGGAAGCTGCTTTCC
GTTCCGTATTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAATACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTCCAGGAATGTCAAATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTTAAACTGCGTCTGGTGATCTATGAGCG
CGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACAGACAACG
GTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGAC
AAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGCATCATCCCTTACCGTGGTTCCTGGCTGGACTTCGA
ATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATTCTGCGTGCCCTGA
ACTACACCACAGAGCAGATCCTCGACCTGTTCTTTGAAAAAGTTATCTTTGAAATCCGTGATAACAAGCTGCAGATGGAA
CTGGTGCCGGAACGCCTGCGTGGTGAAACCGCATCCTTTGACATCGAAGCTAACGGTAAAGTGTACGTAGAAAAAGGCCG
CCGTATCACTGCGCGCCACATTCGCCAGCTGGAAAAAGACGACGTCAAACTGATCGAAGTCCCGGTTGAGTACATCGCAG
GTAAAGTGGTTGCTAAAGACTATATTGATGAGTCTACCGGCGAGCTGATCTGCGCAGCGAACATGGAGCTGAGCCTGGAT
CTGCTGGCTAAGCTGAGCCAGTCTGGTCACAAGCGTATCGAAACGCTGTTCACCAATGATCTGGATCACGGCCCGTATAT
CTCTGAAACCTTACGTGTCGACCCAACTAACGACCGTCTGAGCGCACTGGTAGAAATCTACCGCATGATGCGCCCTGGCG
AGCCGCCGACTCGTGAAGCAGCGGAAAGCCTGTTCGAGAACCTGTTCTTCTCCGAAGACCGTTATGACCTGTCTGCGGTT
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGAAGAAATCGAAGGTTCTGGTATCCTGAGCAAAGACGACATCATTGA
TGTTATGAAAAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTCGATGATATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAAGCCGATTTCCGCAGCAGTGAAAGAGTTCTTCGG
TTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCG
GCCCAGGCGGTCTGACCCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCA
ATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGCACAGACTAACGAATACGGCTTCCT
TGAGACTCCGTATCGTAAAGTGACTGACGGTGTTGTAACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACT
ACGTTATCGCCCAGGCGAACTCCAACCTGGATGAAGAAGGCCACTTCGTAGAAGACCTGGTAACCTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGTGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCGACTCTGC
GTGCTGATAAGCCGCTGGTTGGTACTGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTAACTGCGGTTGCTAAACGT
GGTGGTGTCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGTGAAGCAGG
TATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATTAACCAGATGCCGTGTGTGTCTCTGG
GTGAACCGGTTGAACGTGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTTGGTCAGAACATG
CGCGTAGCGTTCATGCCGTGGAATGGTTACAACTTCGAAGACTCCATCCTCGTATCCGAGCGTGTTGTTCAGGAAGACCG
TTTCACCACCATCCACATTCAGGAACTGGCGTGTGTGTCCCGTGACACCAAGCTGGGGCCAGAAGAGATCACCGCTGACA
TCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTATATTGGTGCGGAAGTGACCGGTGGC
GACATTCTGGTTGGTAAGGTTACGCCGAAAGGTGAAACTCAGCTGACCCCAGAAGAAAAACTGCTGCGTGCGATCTTCGG
TGAGAAAGCGTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTATCCGGTACGGTTATCGACGTTCAGGTCT
TTACTCGCGATGGCGTAGAAAAAGACAAACGTGCGCTGGAAATCGAAGAAATGCAGCTCAAACAGGCGAAGAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCCGTGCTGTGCTGGTAGCCGGTGGCGTTGAAGCTGA
GAAGCTCGACAAATTGCCGCGCGATCGCTGGCTGGAGCTGGGCCTGACCGACGAAGAGAAACAAAATCAGCTGGAACAGC
TGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGAC
GATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCGGTTAAACGCCGTATCCAGCCTGGTGACAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTAATTTCTAAGATCAACCCGATCGAAGATATGCCTTACGATGAAAACGGTACGCCGG
TAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATCCTCGAAACCCACTTGGGTATGGCT
GCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAAACAGCAGCAGGAAGTCGCGAAACTGCGTGAATTCATCCAGCG
TGCGTACGATCTGGGCGCTGACGTTCGTCAGAAAGTTGACCTGAGTACCTTCAGCGATGAAGAAGTTATGCGTCTGGCTG
AAAACCTGCGCAAAGGTATGCCAATCGCAACGCCGGTGTTCGACGGTGCGAAAGAAGCAGAAATTAAAGAGCTGCTGAAA
CTTGGCGACCTGCCGACTTCTGGTCAGATCCGCCTGTACGACGGCCGCACTGGTGAACAGTTCGAACGTCCGGTAACCGT
TGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAGATGCACGCGCGTTCCACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGTTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCA
TACGGCGCAGCATACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACTAAGATGTATAAAAA
CATCGTGGACGGCAACCATCAGATGGAGCCGGGCATGCCAGAATCCTTCAACGTATTGTTGAAAGAGATTCGTTCGCTGG
GTATCAACATCGAACTGGAAGACGAGTAA

>Rif|NC_013450.8613267|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAACCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAACGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGAACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATCGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACACAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>Rif|NC_012469.1.7686402|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGACATGACGTTCAATACGGGAAACATCGTACCCGTCGTAGTTTTTCAAGAATCAAAGAAGTTCTTGACTTACC
AAATTTGATTGAAATTCAAACTGACTCATTCAAAGCTTTCCTAGACCACGGTCTTAAGGAAGTGTTTGAAGATGTATTGC
CAATTTCAAACTTCACAGACACAATGGAGTTGGAATTTGTTGGATATGAAATCAAGGAACCAAAATACACGCTAGAAGAA
GCTCGTATCCACGATGCTAGCTACTCAGCACCAATTTTTGTAACCTTCCGTTTGATCAATAAAGAAACAGGCGAAATCAA
GACCCAAGAAGTTTTCTTTGGTGATTTCCCAATCATGACAGAAATGGGTACTTTCATCATCAATGGTGGTGAACGTATTA
TCGTTTCTCAGTTGGTCCGCTCACCAGGTGTTTACTTTAACGACAAAGTAGACAAAAATGGTAAGGTGGGCTATGGTTCA
ACTGTTATCCCTAACCGTGGAGCTTGGTTGGAACTTGAAAGCGACTCAAAAGATATCACCTACACTCGTATCGACCGTAC
TCGTAAGATTCCATTTACAACCTTGGTTCGTGCTCTTGGTTTCTCAGGTGATGATGAAATCTTTGATATCTTTGGTGACA
GCGAATTGGTTCGCAACACTGTTGAAAAAGATATCCACAAAAATCCAATGGACTCTCGTACAGACGAAGCCTTGAAAGAA
ATTTACGAACGCCTTCGTCCAGGTGAGCCTAAGACAGCTGAAAGCTCACGTAGCTTGCTTGTGGCTCGCTTCTTTGACCC
ACGTCGCTATGACTTGGCAGCAGTTGGTCGTTACAAAATCAATAAAAAACTCAATGTTAAAACACGTTTGCTCAACCAAA
CCATTGCAGAGCCATTGGTAGACCCTGAAACTGGAGAAATCTTGGTAGAAGCTGGTACGATTATGACTCGTAGCGTGATT
GAAAGCATTGAAAGCCATTTGGATGGCGACTTGAACAAGATTGTCTACATCCCAAACGATGCAGCCGTTGTGACTGAGCC
TGTTGTTCTTCAAAAATTCAAGGTTGTTGCTCCAACTGATCCAGATCGCGTCGTAACGATCATTGGTAATGCTAACCCAG
ATGACAAGGTTCGTACGGTGACTCCTGCAGATATCCTTGCTGAGATGAGCTACTTCCTCAACTTGGCTGAAGGACTTGGC
CGTGTAGATGATATCGACCACCTTGGAAATCGTCGTATCCGTGCGGTTGGTGAATTGCTTGCCAACCAAGTACGTTTGGG
ACTTTCTCGTATGGAACGTAATGTCCGTGAACGTATGTCTGTTCAGGACAATGAAGTCTTGACACCACAACAAATTATCA
ATATCCGTCCTGTAACAGCTGCAGTTAAAGAATTCTTTGGTTCATCACAGTTGTCACAGTTCATGGACCAACACAACCCG
CTTTCTGAGTTGTCTCACAAACGCCGTTTGTCAGCCTTAGGACCTGGTGGTTTGACTCGTGACCGTGCTGGATATGAAGT
ACGTGACGTGCACTACACTCACTATGGTCGTATGTGTCCAATCGAGACACCTGAAGGACCTAACATCGGTTTGATCAATA
ACTTGTCATCTTACGGACACTTGAACAAATATGGTTTTGTTCAAACACCATACCGTAAGGTTGACCGTGAAACAGGTGTT
GTCACGAACGAAATTGTTTGGTTGACAGCTGATGAAGAAGATGAATATACTGTAGCTCAGGCTAACTCTCGTCTGAATGA
AGATGGAACCTTTGCTGAGAAGATTGTCATGGGACGTCACCAAGGGGTCAACCAAGAGTATCCAGCTAATATTGTTGACT
ACATGGACGTTTCACCAAAACAGGTAGTTGCCGTTGCGACAGCATGTATTCCTTTCTTGGAAAACGATGACTCCAACCGT
GCCCTCATGGGAGCCAATATGCAACGTCAGGCTGTGCCATTGATTAATCCTCAGGCACCTTACGTTGGTACTGGTATGGA
ATACCAAGCAGCCCACGATTCTGGTGCGGCTGTGATTGCTCAGTATGATGGTAAAGTTACTTACGCAGATGCTGACAAGG
TAGAAGTTCGTCGTGAAGATGGATCATTGGATGTTTACCACATCCAAAAATTCCGTCGTTCAAACTCAGGTACTGCTTAC
AACCAACGCACTCTCGTAAAAGTTGGTGATGTCGTTGAAAAAGGCGATTTCATCGCTGACGGACCTTCTATGGAAAATGG
AGAAATGGCGCTTGGACAAAACCCAATCGTTGCCTACATGACTTGGGAAGGTTACAACTTCGAGGATGCCGTTATCATGA
GCGAACGCTTGGTGAAGGACGATGTCTACACATCTGTTCACCTTGAAGAATACGAATCAGAAACGCGCGATACAAAGCTT
GGGCCTGAAGAAATCACTCGCGAAATTCCAAACGTTGGTGAAGATGCCCTCAAAGACCTTGACGAAATGGGGATTATCCG
TATTGGTGCTGAGGTTAAAGAAGGTGATATTCTTGTAGGTAAAGTAACACCTAAGGGTGAGAAAGATCTTTCAGCTGAAG
AACGTCTCTTGCACGCTATCTTTGGAGACAAGTCTCGTGAAGTGCGTGATACTTCTCTTCGTGTACCACACGGTGCCGAT
GGTGTCGTTCGTGATGTTAAGATCTTTACACGTGTAAATGGAGATGAGTTGCAATCAGGTGTTAACATGTTGGTTCGTGT
TTACATCGCTCAAAAACGTAAGATTAAGGTCGGAGATAAAATGGCCGGACGTCACGGAAACAAAGGGGTTGTCTCTCGTA
TCGTTCCTGTAGAAGACATGCCTTACCTTCCAGACGGAACTCCAGTCGACATCATGTTGAACCCACTTGGGGTGCCATCA
CGTATGAATATCGGTCAGGTTATGGAGCTTCACCTTGGTATGGCAGCTCGTACTCTTGGTATTCACATTGCGACACCAGT
CTTTGATGGAGCAAGTTCTGAAGATCTTTGGTCAACTGTTAAAGAAGCAGGTATGGATAGCGATGCCAAAACGATCCTTT
ACGATGGACGTACTGGTGAACCATTTGATAACCGTGTTTCTGTTGGAGTCATGTACATGATCAAACTCCACCACATGGTT
GACGATAAATTGCACGCGCGTTCAGTCGGACCTTACTCAACTGTTACCCAACAACCACTCGGAGGTAAAGCTCAGTTTGG
TGGACAACGTTTCGGTGAGATGGAGGTTTGGGCTCTTGAAGCCTACGGTGCGTCAAATGTCCTTCAAGAAATCTTGACTT
ACAAGTCTGACGATATCAACGGACGTTTGAAAGCCTATGAAGCTATTACAAAAGGCAAACCAATTCCAAAACCAGGTGTT
CCAGAATCCTTCCGAGTTCTTGTCAAAGAATTGCAATCTCTTGGTCTTGACATGCGTGTCCTAGACGAAGATGACCAAGA
AGTGGAACTTCGCGACTTGGATGAAGGAATGGACGAAGATGTCATCCACGTAGATGACCTTGAAAAAGCCCGCGAAAAAG
CAGCCCAAGAGGCTAAAGCAGCCTTTGAAGCTGAAGAAGCTGAGAAAGCAACAAAAGCGGAAGCAACAGAAGAAGCTGCT
GAACAAGAATAA

>CARD|pvgb|AL123456|759806-763325|ARO:3003283|Mycobacterium|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGATTCCCGCCAGAGCAAAACAGCCGCTAGTCCTAGTCCGAGTCGCCCGCAAAGTTCCTCGAATAACTCCGTACC
CGGAGCGCCAAACCGGGTCTCCTTCGCTAAGCTGCGCGAACCACTTGAGGTTCCGGGACTCCTTGACGTCCAGACCGATT
CGTTCGAGTGGCTGATCGGTTCGCCGCGCTGGCGCGAATCCGCCGCCGAGCGGGGTGATGTCAACCCAGTGGGTGGCCTG
GAAGAGGTGCTCTACGAGCTGTCTCCGATCGAGGACTTCTCCGGGTCGATGTCGTTGTCGTTCTCTGACCCTCGTTTCGA
CGATGTCAAGGCACCCGTCGACGAGTGCAAAGACAAGGACATGACGTACGCGGCTCCACTGTTCGTCACCGCCGAGTTCA
TCAACAACAACACCGGTGAGATCAAGAGTCAGACGGTGTTCATGGGTGACTTCCCGATGATGACCGAGAAGGGCACGTTC
ATCATCAACGGGACCGAGCGTGTGGTGGTCAGCCAGCTGGTGCGGTCGCCCGGGGTGTACTTCGACGAGACCATTGACAA
GTCCACCGACAAGACGCTGCACAGCGTCAAGGTGATCCCGAGCCGCGGCGCGTGGCTCGAGTTTGACGTCGACAAGCGCG
ACACCGTCGGCGTGCGCATCGACCGCAAACGCCGGCAACCGGTCACCGTGCTGCTCAAGGCGCTGGGCTGGACCAGCGAG
CAGATTGTCGAGCGGTTCGGGTTCTCCGAGATCATGCGATCGACGCTGGAGAAGGACAACACCGTCGGCACCGACGAGGC
GCTGTTGGACATCTACCGCAAGCTGCGTCCGGGCGAGCCCCCGACCAAAGAGTCAGCGCAGACGCTGTTGGAAAACTTGT
TCTTCAAGGAGAAGCGCTACGACCTGGCCCGCGTCGGTCGCTATAAGGTCAACAAGAAGCTCGGGCTGCATGTCGGCGAG
CCCATCACGTCGTCGACGCTGACCGAAGAAGACGTCGTGGCCACCATCGAATATCTGGTCCGCTTGCACGAGGGTCAGAC
CACGATGACCGTTCCGGGCGGCGTCGAGGTGCCGGTGGAAACCGACGACATCGACCACTTCGGCAACCGCCGCCTGCGTA
CGGTCGGCGAGCTGATCCAAAACCAGATCCGGGTCGGCATGTCGCGGATGGAGCGGGTGGTCCGGGAGCGGATGACCACC
CAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCAC
CAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGC
CCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATC
GAAACCCCTGAGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAACCCGTTCGGGTTCATCGA
AACGCCGTACCGCAAGGTGGTCGACGGCGTGGTTAGCGACGAGATCGTGTACCTGACCGCCGACGAGGAGGACCGCCACG
TGGTGGCACAGGCCAATTCGCCGATCGATGCGGACGGTCGCTTCGTCGAGCCGCGCGTGCTGGTCCGCCGCAAGGCGGGC
GAGGTGGAGTACGTGCCCTCGTCTGAGGTGGACTACATGGACGTCTCGCCCCGCCAGATGGTGTCGGTGGCCACCGCGAT
GATTCCCTTCCTGGAGCACGACGACGCCAACCGTGCCCTCATGGGGGCAAACATGCAGCGCCAGGCGGTGCCGCTGGTCC
GTAGCGAGGCCCCGCTGGTGGGCACCGGGATGGAGCTGCGCGCGGCGATCGACGCCGGCGACGTCGTCGTCGCCGAAGAA
AGCGGCGTCATCGAGGAGGTGTCGGCCGACTACATCACTGTGATGCACGACAACGGCACCCGGCGTACCTACCGGATGCG
CAAGTTTGCCCGGTCCAACCACGGCACTTGCGCCAACCAGTGCCCCATCGTGGACGCGGGCGACCGAGTCGAGGCCGGTC
AGGTGATCGCCGACGGTCCCTGTACTGACGACGGCGAGATGGCGCTGGGCAAGAACCTGCTGGTGGCCATCATGCCGTGG
GAGGGCCACAACTACGAGGACGCGATCATCCTGTCCAACCGCCTGGTCGAAGAGGACGTGCTCACCTCGATCCACATCGA
GGAGCATGAGATCGATGCTCGCGACACCAAGCTGGGTGCGGAGGAGATCACCCGCGACATCCCGAACATCTCCGACGAGG
TGCTCGCCGACCTGGATGAGCGGGGCATCGTGCGCATCGGTGCCGAGGTTCGCGACGGGGACATCCTGGTCGGCAAGGTC
ACCCCGAAGGGTGAGACCGAGCTGACGCCGGAGGAGCGGCTGCTGCGTGCCATCTTCGGTGAGAAGGCCCGCGAGGTGCG
CGACACTTCGCTGAAGGTGCCGCACGGCGAATCCGGCAAGGTGATCGGCATTCGGGTGTTTTCCCGCGAGGACGAGGACG
AGTTGCCGGCCGGTGTCAACGAGCTGGTGCGTGTGTATGTGGCTCAGAAACGCAAGATCTCCGACGGTGACAAGCTGGCC
GGCCGGCACGGCAACAAGGGCGTGATCGGCAAGATCCTGCCGGTTGAGGACATGCCGTTCCTTGCCGACGGCACCCCGGT
GGACATTATTTTGAACACCCACGGCGTGCCGCGACGGATGAACATCGGCCAGATTTTGGAGACCCACCTGGGTTGGTGTG
CCCACAGCGGCTGGAAGGTCGACGCCGCCAAGGGGGTTCCGGACTGGGCCGCCAGGCTGCCCGACGAACTGCTCGAGGCG
CAGCCGAACGCCATTGTGTCGACGCCGGTGTTCGACGGCGCCCAGGAGGCCGAGCTGCAGGGCCTGTTGTCGTGCACGCT
GCCCAACCGCGACGGTGACGTGCTGGTCGACGCCGACGGCAAGGCCATGCTCTTCGACGGGCGCAGCGGCGAGCCGTTCC
CGTACCCGGTCACGGTTGGCTACATGTACATCATGAAGCTGCACCACCTGGTGGACGACAAGATCCACGCCCGCTCCACC
GGGCCGTACTCGATGATCACCCAGCAGCCGCTGGGCGGTAAGGCGCAGTTCGGTGGCCAGCGGTTCGGGGAGATGGAGTG
CTGGGCCATGCAGGCCTACGGTGCTGCCTACACCCTGCAGGAGCTGTTGACCATCAAGTCCGATGACACCGTCGGCCGCG
TCAAGGTGTACGAGGCGATCGTCAAGGGTGAGAACATCCCGGAGCCGGGCATCCCCGAGTCGTTCAAGGTGCTGCTCAAA
GAACTGCAGTCGCTGTGCCTCAACGTCGAGGTGCTATCGAGTGACGGTGCGGCGATCGAACTGCGCGAAGGTGAGGACGA
GGACCTGGAGCGGGCCGCGGCCAACCTGGGAATCAATCTGTCCCGCAACGAATCCGCAAGTGTCGAGGATCTTGCGTAAA

>Rif|NC_003112.2.902240|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
GTGTGTATGAACTATTCGTTTACCGAGAAAAAACGTATCCGTAAGAGTTTTGCAAAGCGGGAAAATGTTTTGGAAGTTCC
TTTCTTGCTAGCAACCCAAATTGATTCTTATGCGAAGTTTTTGCAGCTGGAAAATGCTTTTGACAAACGTACCGATGACG
GTCTGCAGGCGGCATTTAATTCTATTTTCCCGATTGTGAGCCATAACGGTTATGCGCGATTGGAGTTTGTGCATTACACA
TTGGGCGAGCCTTTGTTCGATATTCCCGAATGTCAGTTGCGCGGAATCACTTATGCAGCCCCCTTGCGCGCGCGTATCCG
TTTGGTGATTTTGGATAAGGAAGCATCTAAACCGACGGTAAAAGAAGTTCGTGAAAACGAAGTGTATATGGGCGAAATTC
CGTTGATGACCCCGAGCGGTTCTTTTGTGATTAACGGCACAGAGCGTGTGATTGTCTCCCAGTTGCACCGTTCGCCCGGC
GTATTCTTCGAGCATGACAAAGGTAAGACGCACTCTTCCGGCAAATTGTTATTCTCCGCCCGCATCATTCCCTACCGTGG
TTCATGGTTGGATTTTGAATTTGATCCGAAAGATTTGCTGTATTTCCGTATCGACCGCCGCCGTAAAATGCCGGTAACGA
TTTTGTTGAAGGCTTTAGGCTACAACAATGAGCAAATCTTGGATATTTTCTACGACAAAGAAACGTTCTATTTGTCTTCA
AACGGTGTTCAAACCGATTTGGTTGCAGACCGTCTGAAAGGCGAAACTGCCAAGGTCGATATCTTGGATAAAGAAGGCAA
TGTATTGGTTGCCAAAGGTAAGCGCATTACTGCGAAAAATATCCGTGATATTACCAATGCAGGCCTGACCCGTTTGGATG
TAGAACCGGAAAGCCTGCTGGGCAAAGCATTGGCTGCCGATCTGATTGATTCGGAAACCGGCGAGGTATTGGCTTCTGCC
AATGATGAAATTACAGAAGAGTTGTTGGCCAAATTTGATATCAACGGCGTAAAAGAAATTACGACCCTTTATATCAATGA
GCTGGATCAGGGTGCTTATATCTCCAATACCTTGCGTACGGATGAGACTGCCGGCCGGCAGGCGGCTCGTGTTGCGATTT
ACCGTATGATGCGTCCGGGCGAACCGCCCACCGAAGAGGCGGTCGAGCAATTGTTTAACCGCTTGTTCTTCAGTGAAGAC
AGCTACGATCTGTCCCGCGTAGGCCGTATGAAATTTAATACGCGCACATACGAACAAAAACTGTCCGAAGCCCAACAAAA
CTCTTGGTACGGCCGCCTGCTGAACGAAACGTTTGCCGGTGCTGCCGACAAAGGCGGTTATGTCCTGAGCGTCGAAGATA
TTGTCGCCTCGATTGCGACTTTGGTCGAGTTGCGTAACGGCCATGGCGAAGTGGACGATATCGATCACTTGGGCAACCGC
CGAGTACGTTCGGTAGGCGAGCTGACTGAAAACCAATTCCGTAGCGGTTTGGCCCGTGTGGAACGTGCCGTAAAAGAACG
TTTGAATCAGGCGGAATCAGAAAACTTGATGCCGCACGATTTGATTAATGCAAAACCTGTTTCTGCCGCTATTAAAGAAT
TCTTCGGCTCCAGCCAATTGAGTCAGTTTATGGATCAGACCAACCCCTTGTCTGAAGTAACCCATAAACGCCGTGTATCT
GCATTGGGTCCGGGCGGTTTGACCCGCGAACGTGCAGGATTTGAGGTGCGGGACGTGCATCCGACCCACTACGGTCGCGT
ATGTCCGATTGAAACGCCTGAAGGTCCGAACATCGGTTTGATCAACTCATTGTCCGTTTATGCGCGCACCAATGATTACG
GTTTCTTGGAAACGCCTTACCGCCGCGTTATCGACGGCAAAGTAACCGAGGAAATCGATTACTTGTCTGCCATCGAAGAA
GGCCGCTATGTGATTGCACAGGCGAATGCCGATTTGGATTCAGATGGCAATCTGATTGGCGATTTGGTTACCTGTCGTGA
AAAAGGCGAAACCATTATGGCAACGCCCGACCGCGTCCAATATATGGACGTGGCAACTGGTCAAGTGGTATCCGTTGCAG
CATCCCTGATTCCATTCTTGGAACATGATGACGCGAACCGCGCATTGATGGGTGCCAACATGCAACGTCAGGCAGTGCCT
TGCTTGCGTCCTGAAAAACCGATGGTCGGTACCGGTATCGAGCGTTCCGTTGCCGTTGACTCTGCTACTGCAATCGTTGC
CCGCCGAGGCGGCGTGGTCGAGTATGTCGATGCCAACCGCGTTGTGATCCGTGTCCATGACGACGAAGCGACTGCCGGTG
AAGTGGGTGTCGATATTTACAACTTGGTTAAATTCACCCGTTCCAACCAGTCTACCAATATCAATCAGCGTCCTGCCGTC
AAAGCCGGCGATGTTTTGCAACGCGGCGATTTGGTGGCCGACGGCGCGTCCACCGATTTTGGCGAATTGGCTTTGGGTCA
AAATATGACCATCGCCTTCATGCCGTGGAACGGTTACAACTACGAAGACTCGATTCTGATTTCCGAAAAAGTGGCTGCGG
ACGACCGCTATACTTCGATTCACATTGAGGAATTGAATGTCGTTGCCCGCGATACTAAGCTGGGTGCGGAAGACATTACC
CGCGATATTCCGAACTTGTCCGAGCGTATGCAAAACCGTTTGGACGAATCCGGTATCGTTTACATCGGTGCGGAAGTAGA
AGCCGGCGATGTGTTGGTAGGCAAGGTAACGCCTAAAGGCGAAACCCAACTGACGCCGGAAGAAAAACTGCTGCGCGCCA
TCTTCGGTGAAAAAGCATCTGACGTAAAAGATACTTCATTGCGTATGCCTACCGGCATGAGCGGTACCGTTATCGACGTT
CAAGTCTTCACTCGTGAAGGTATTCAACGCGACAAACGTGCTCAATCCATTATCGATTCCGAATTGAAACGCTACCGTTT
GGATTTGAACGACCAATTGCGTATTTTCGACAACGACGCATTCGACCGTATCGAGCGTATGATTGTCGGTCAGAAAGCCA
ACGGTGGTCCGATGAAGCTGGCCAAAGGCAGCGAAATCACGACCGAATATCTGGCGGGTCTGCCGAGCAGGCACGATTGG
TTCGATATCCGTCTGACCGATGAAGATTTGGCCAAGCAGTTGGAACTGATTAAAGTGAGCCTGCAACAAAAACGCGAAGA
AGCGGACGAGTTATACGAAATCAAGAAGAAAAAACTGACCCAAGGCGACGAATTGCAACCCGGCGTACAAAAAATGGTGA
AAGTTTTTATCGCCATCAAACGCCGTCTGCAAGCCGGCGACAAAATGGCGGGCCGCCACGGTAACAAAGGCGTGGTATCG
CGCATTCTGCCAGTGGAAGACATGCCTTACATGGCGGACGGCCGTCCGGTAGACATCGTACTGAACCCATTGGGCGTACC
TTCCCGTATGAACATCGGTCAGATTTTGGAAGTTCACTTGGGTTGGGCAGCAAAAGGTATCGGCGAGCGTATCGACCGTA
TGCTGAAAGAGCAACGCAAAGCAGGCGAGTTGCGCGAGTTCTTGAACAGACTCTACAACGGCAGCGGTAAGAAAGAAGAT
TTGGATGCCCTGACTGATGAAGAAATCATCGAACTGGCCTCCAACCTGCGCAAAGGTGCATCTTTCGCCTCTCCTGTATT
CGACGGTGCGAAAGAGTCTGAAATCCGCGAAATGCTGAACTTGGCTTATCCGAGCGACGATCCTGAGGTTGAAAAACTGG
GCTTCAACGACAGTAAAACCCAAATCACGCTGTATGACGGCCGTTCAGGCGAAGCATTTGACCGCAAGGTTACAGTAGGT
GTGATGCACTATCTGAAACTGCACCACTTGGTTGACGAAAAAATGCACGCGCGTTCTACCGGTCCGTACAGTCTGGTTAC
CCAGCAGCCTTTGGGCGGTAAAGCCCAGTTCGGCGGCCAACGTTTCGGCGAGATGGAGGTTTGGGCATTGGAAGCATACG
GCGCGGCATACACGCTGCAAGAGATGCTGACTGTGAAGTCTGACGACGTGAACGGCCGTACCAAAATGTACGAAAACATC
GTCAAAGGCGAACACAAAATCGATGCCGGTATGCCCGAGTCCTTCAACGTATTGGTCAAAGAGATTCGCTCACTGGGCTT
GGATATCGATTTGGAACGTTACTAA

>Rif|CP003583.1|gene2745|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
GTGAAGAGCTTGGCTGGACACGTAGTAAAATACGGAAAACATCGCGAACGTAGAAGTTTCGCAAGAATCAGTGAAGTGTT
GGAATTACCAAATTTGATCGAAATTCAAACAGACTCTTACCAATGGTTCTTAGATGAGGGACTTAGAGAAATGTTTGAAG
ACATTTTGCCAATCGATGACTTCAATGGCAATCTATCTTTGGAATTTGTAGATTATGAATTGAAAGAACCAAAGTATACA
GTAGCAGAAGCTCGTGCGCATGATGCAAACTACTCTGCACCATTACATGTAACATTGCGTTTGACAAACCGCGAGACTGG
CGAAATCAAAGCACAAGAAGTATTCTTCGGTGATTTCCCATTAATGACAGAACAAGGAACATTCATCATCAACGGGGCAG
AGCGAGTAATCGTTTCTCAGTTAGTCCGTTCACCAGGTGTCTATTTCCATGGAAAAGTCGACAAAAACGGAAAAGAAGGA
TTCGGTTCTACTGTTATCCCTAACCGTGGAGCTTGGCTAGAAATGGAAACTGATGCAAAAGACATCTCTTATGTACGTAT
CGACCGTACACGTAAGATTCCTTTAACCGTATTAGTTCGTGCGTTAGGATTTGGTTCCGATGATACGATCTTTGAAATCT
TCGGCGACAGCGAAACATTACGCAATACAGTCGAAAAAGACTTGCATAAAAACGCAAGCGACTCAAGAACAGAAGAAGGT
TTGAAAGACGTTTACGAACGTTTGCGTCCAGGCGAACCAAAAACAGCAGACAGCTCACGTAACTTGCTGAATGCTCGTTT
CTTCGATCCAAAACGTTACGACTTAGCAAACGTTGGTCGTTACAAAGTAAACAAAAAATTAGATTTGAAAACACGTCTAT
TGAATCTGACATTAGCTGAAACATTAGTTGATCCAGAAACAGGCGAGATCATCGTTGAAAAAGGAACAGTTCTGACTCAC
CAAGTCATGGAAACACTAGCTCCTTTCATTGATAATGGCCTAAATTCAGTGACTTACTATCCATCAGAAGACGGTGTGGT
CACAGATCCAATGACTGTCCAAGTCATCAAAGTATTTTCACCAAGAGACCCTGAACGTGAAGTAAACGTGATCGGAAACG
GCTATCCAGAAGCAGCTGTAAAAACGGTTCGTCCAGCCGACATCATTGCTTCAATGAGCTATTTCTTGAACTTGATGGAA
GGTATCGGCAATGTCGATGATATCGACCACTTAGGAAATCGTCGTATCCGTTCAGTCGGTGAACTTTTACAAAACCAATT
CCGTATCGGGCTAGCACGTATGGAACGTGTGGTTCGTGAAAGAATGTCGATCCAAGATACTGAAACATTGACACCTCAAC
AATTGATCAATATCCGTCCAGTTGTGGCAAGTATCAAAGAATTCTTTGGTTCTTCTCAGTTGTCACAGTTCATGGATCAA
ACAAACCCTCTTGGCGAATTGACACACAAACGTCGTCTTTCAGCCTTAGGACCTGGCGGATTGACTCGTGACCGCGCCGG
TTATGAAGTTCGTGACGTTCACTACTCCCACTATGGCCGTATGTGTCCGATCGAAACTCCTGAAGGCCCAAACATCGGGT
TGATCAATAGTTTGTCCAGTTATGCGAAAGTAAATAAATTCGGATTTATCGAAACACCTTATCGTCGTGTAGACCGTGAA
ACAGGTCGTGTTACTGACCAAATCGACTACTTGACAGCTGATATCGAAGACCATTACATCGTAGCCCAAGCAAACAGCCC
ATTGAATGAAGATGGAACATTTGCTCAAGACGTTGTTATGGCTCGTGCTCAAAGTGAAAACTTAGAAGTATCTATTGATA
AAGTAGACTACATGGACGTATCACCTAAACAAGTAGTTGCCGTTGCGACAGCATGTATTCCTTTCTTGGAAAACGATGAC
TCCAACCGTGCCTTGATGGGTGCCAACATGCAGCGTCAAGCAGTGCCGTTGATCAATCCTCAAGCACCATGGGTTGGTAC
TGGTATGGAATACAAATCAGCGCATGACTCAGGAGCTGCTTTGTTATGTAAACATGACGGTGTCGTTGAATACGTTGATG
CTTCTGAAATCCGCGTACGCCGCGACAACGGTGCATTAGATAAATACGATGTAACAAAATTCCGTCGTTCAAACTCCGGA
ACAAGCTACAACCAACGTCCAATCGTTCATTTGGGTGAGAAAGTCGAAAAAGGGGATACTCTGGCAGACGGACCATCTAT
GGAACAAGGCGAAATGGCTCTAGGCCAAAACGTTTTAGTTGGTTTCATGACTTGGGAAGGGTACAACTATGAAGATGCGA
TCATCATGAGCCGTCGTTTGGTAAAAGATGACGTATACACTTCTATCCATATTGAAGAATATGAATCAGAAGCCCGCGAT
ACAAAATTAGGACCTGAAGAAATCACACGCGAAATCCCTAATGTCGGGGAAGACGCATTAAAAGATTTAGACGAAATGGG
TATCATCCGTATTGGTGCAGAAGTCCAAGATGGCGATTTGCTTGTAGGGAAAGTCACGCCAAAAGGGGTAACAGAATTAT
CTGCAGAAGAACGTCTATTGCATGCGATCTTTGGCGAAAAAGCTCGTGAAGTCCGCGATACATCATTACGTGTACCACAT
GGCGGCGGCGGTATCGTTCACGATGTGAAAATCTTTACTCGTGAAGCTGGAGATGAATTGTCACCAGGCGTAAACATGTT
AGTTCGTGTTTATATCGTTCAAAAACGTAAAATCCATGAAGGGGATAAAATGGCCGGTCGTCACGGAAATAAAGGGGTTG
TATCCCGTATTATGCCGGAAGAAGATATGCCATTCCTACCTGATGGAACACCAATCGATATCATGCTGAATCCTTTAGGG
GTGCCTTCACGTATGAACATCGGGCAAGTATTGGAATTACACTTGGGTATGGCTGCACGTCAGTTAGGTATCCACGTAGC
AACGCCAGTATTTGATGGTGCAAGTGATGAAGACGTATGGGAAACAGTTCGTGAAGCCGGTATGGCCAGCGATGCGAAAA
CTGTTCTGTACGACGGACGTACAGGTGAACCATTTGATGGACGTGTGTCTGTCGGTGTGATGTACATGATCAAACTTGCT
CACATGGTCGATGACAAATTGCATGCACGTTCAATCGGACCTTACTCATTGGTTACACAACAACCATTGGGAGGTAAAGC
TCAATTTGGTGGACAACGTTTTGGTGAAATGGAAGTATGGGCACTGGAAGCTTACGGTGCGGCTTATACTTTACAAGAAA
TCTTGACATACAAATCAGATGACGTAGTCGGACGTGTGAAAACATACGAAGCAATCGTCAAGGGTGAACCAATTCCAAAA
CCAGGTGTACCGGAATCATTCCGCGTATTGGTGAAAGAATTGCAATCACTAGGTCTGGACATGCGTGTCTTGGATATCGA
AGAAACAGAGATCGAACTTCGCGACATGGACGATGAAGACGACGATTTGATCACTGTTGATGCTTTGACAAAATTTGCCG
AACAGCAAACTGCCAAAGAATTAGAAAAGAAAGCTGCTGAACAAGTGGAAGATGAAAAAGACGATGTCATCCAAAACTTT
GAAACCGCAGAAGATAATTTAGACTAA

>Rif|NC_010611.6233925|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCATACTCATATACCGAAAAGAAACGGATCCGTAAGAATTTTGGTAAATTGCCCCAAGTAATGGATGCACCGTACTT
ATTATCGATTCAGGTCGATTCGTACAGAACATTCTTGCAAGATGGCAAATCACCAAAAAACCGCGAAGATATCGGTCTCC
AAGCCGCATTTCGTTCAGTTTTTCCTATCGAAAGTTATTCTGGCAATGCTGCTTTAGAATTTGTTGAGTATAGCCTTGGT
AAACCTGAGTTCGATGTACGCGAATGTATTCTTCGTGGCTCGACTTATGCGGCACCAATGCGCGTTAAAATTCGTTTGAT
TATTAAAGATCGCGAAACTAAATCAATTAAAGACGTACGCGAACAAGAAGTCTATATGGGTGAAATTCCACTCATGACTG
AAAATGGTACCTTTGTTATCAACGGTACTGAGCGTGTAATCGTATCTCAATTACACCGTTCGCCAGGCGTATTCTTTGAC
CATGATAAAGGTAAGACCCACTCAAGTGGTAAAGTGTTGTATTCAGCACGTATCATTCCTTACCGTGGTTCATGGTTAGA
CTTCGAATTTGATGCAAAAGACTTAGTTTACGTACGTATCGACCGTCGTCGTAAATTACTTGCTACAGTTGTGTTACGTG
CACTAGGTTATAACAATGAACAGATCTTGAATTTGTTCTATGAAAAAGTACCTGTGTATCTTGACATGGGTAGCTATCAA
ATTGACCTCGTACCTGAGCGTTTACGTGGTGAAATGGCTCAATTTGATATTACTGACAATGAAGGTAAAGTCATTGTTGA
GCAAGGTAAACGTATTAATGCTCGTCATGTACGTCAAATGGAAGCTGCAGGTTTAACTAAGCTTTCAGTTCCTGATGAAT
ACTTATATGAGCGTATCACTGCTGAAGATATTACTCTACGTGATGGTGAAGTAATTGCTGCAAATACTCTGTTAAGCCAT
GAAGTAATGGTGAAGTTGGCAGAAGGTGGTGTTAAGCAATTTAATATCTTGTTCACTAACGATATTGACCGTGGTTCATT
CGTAGCTGATACATTACGTGCTGACTTGACGCGTGATCGTGAAGAAGCATTAGTAGAAATCTACAAAGTAATGCGTCCAG
GCGAGCCACCAACAAAAGAAGCTGCTGAAAACTTATTCAATAACTTGTTCTTCTCTTCTGAACGCTATGACTTATCTCCA
GTAGGTCGTATGAAGTTCAACCGTCGTTTAGGTCGTCCTTACGAAGTTGGTACTGATCAGAAGTCACGCGAAGTTGAAGG
TATTTTATCGCACGAAGATATTATCGATGTATTACGTACATTGGTTGAAATCCGTAACGGTAAAGGTGAAGTCGACGATA
TCGACCACTTAGGTAACCGTCGTGTACGTTCTGTTGGTGAAATGACAGAGAACCAATTCCGTGTAGGTTTAGTTCGTGTT
GAGCGTGCTGTTAAAGAGCGTTTAAGCCAAGCAGAAACAGATAACTTGTCTCCACAAGATTTGATTAATGCAAAACCAGT
TGCTGCTGCAATCAAAGAATTCTTTGGTTCAAGCCAGTTATCTCAGTTTATGGACCAAAACAACCCATTATCTGAGATTA
CACATAAACGTCGTGTATCTGCGCTTGGTCCTGGTGGTTTAACACGTGAACGTGCAGGCTTCGAAGTACGTGACGTACAC
CAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTGATCAACTCGCTTTCTGTATA
CGCAAAAGCGAATGACTTCGGTTTCTTGGAAACACCATACCGCAAAGTTGTAGATGGTCGTGTAACTGATGATGTTGAAT
ATTTATCTGCAATTGAAGAAGTAGGTACTGTTATTGCACAGGCCGACTCTGCTGTAGATAAAGATGGCAACTTAACAGAA
GAATTCGTTTCTGTTCGTCATCAAGGTGAATTCGTACGTATGCCGCCTGAAAAAGTAACGCATATGGACGTTTCTGCACA
GCAGGTAGTATCTGTTGCTGCATCACTTATTCCATTCCTTGAACACGATGACGCAAACCGTGCGCTCATGGGTTCAAACA
TGCAACGTCAGGCAGTTCCTACTTTACGTGCGGATAAACCGCTTGTAGGTACAGGTATGGAAGCGAACGTTGCACGTGAC
TCTGGTGTGTGTGTAATCGCAAACCGTGGCGGTGTAATTGAATATGTAGATGCTTCTCGTATCGTTATTCGTGTAAACGA
AGATGAAATGGTTGCAGGTGAGGCAGGTGTAGATATCTATAACCTCATCAAATATACGCGTTCAAACCAAAATACTTGTA
TTAACCAAAATGTTATCGTGAACTTGGGCGACAAAGTTGCTCGTGGTGACATCTTGGCAGACGGTCCGTCAACAGACATG
GGTGAACTTGCGCTTGGTCAAAACATGCGTGTAGCGTTCATGACATGGAATGGTTACAACTACGAAGACTCGATCTTGTT
ATCTGAGCGTGTACTTCAAGAAGACCGTTTAACCTCTATTCACATTCAAGAATTGTCATGTGTAGCACGTGATACTAAGT
TAGGTGCAGAAGAAATTACTGCCGATATTCCTAACGTAGGTGAAGCTGCGCTTTCTAAACTTGATGAATCAGGTATCGTT
TATATCGGTGCTGAAGTTACTGCTGGTGACATCTTAGTTGGTAAAGTAACGCCTAAAGGTGAAACTCAGTTAACTCCTGA
AGAAAAACTGCTTCGTGCAATTTTTGGTGAGAAAGCAGCTGACGTTAAAGACTCATCTTTACGTGTTCCATCTGGTACTA
AAGGTACAGTTATTGACGTTCAAGTCTTCACTCGTGATGGCTTAGAGAAAGATGACCGTGCTTTAGCAATTGAAAAAGCA
CAGCTTGATTCTTATCGTAAAGACTTGAAAGAAGAATACAAGATCTTCGAAGAAGCGGCTCGTGAGCGTGTAATTCGTTT
GCTTAAAGGCCAAGAGTCTAATGGCGGTGGTTCAACTAAACGTGGTGATAAACTTTCTGAAGATTTATTATCTGGTTTAG
AGCTTGTTGACTTACTTGAAATTCAACCAGCAGATGAAGCAATCGCTGAGCGTTTAACTCAAATTCAAGTGTTCTTGAAA
GAGAAGAGCGCAGAAATCGATGAGAAATTCGCTGAGAAGAAACGTAAGCTTGCAACAGGTGATGAATTAACAACTGGTGT
ATTGAAAGTTGTTAAAGTTTACTTAGCTGTTAAACGTCGTATTCAGCCTGGTGATAAGATGGCTGGTCGTCACGGTAACA
AAGGTGTTGTATCTAACATCTTACCTGTTGAAGACATGCCACATGATGCTAACGGTGTGCCGGTAGATATCGTATTGAAC
CCGCTGGGTGTACCATCTCGTATGAACGTGGGTCAGATTCTAGAGACTCACTTGGGTATGGCGGCTAAAGGGCTTGGTGA
CAAAATCGAAAAAATGTTGAAAGAACAACGTACAGTTTTAGAACTGCGCGAATTCTTAGACAAGATTTATAACAAAGTCG
GCGGTGAGCAAGAAGATCTTGATAGCTTGACTGATGAAGAAATTCTAGCGCTTGCAGGTAACTTGCGTGCGGGTGTGCCT
TTAGCTACTCCTGTATTTGATGGTGCTGAAGAAAGTCAAATTAAAGACTTACTTGAATTGGCTGACATTTCACGTACTGG
TCAAACAGTATTGTTTGACGGACGTACAGGTGAACAGTTTGACCGTCCAGTAACTGTTGGTTACATGTACATGCTTAAAT
TGAACCACTTGGTTGATGACAAGATGCATGCGCGTTCAACTGGTTCTTACTCACTTGTTACACAACAACCGCTTGGTGGT
AAAGCACAATTCGGTGGTCAGCGTTTCGGTGAGATGGAAGTATGGGCACTTGAAGCATACGGTGCAGCATATACACTCCA
AGAAATGCTTACAGTGAAGTCGGATGACGTTGAAGGCCGTACTCGCATCTATAAGAATATTGTAGATGGTAACCATTATA
TGGATCCGGGTATGCCTGAATCGTTCAACGTATTGACCAAAGAGATCCGTTCTTTAGGTATCAACATTGAACTAAAAAAT
GGTGACTAA

>Rif|CP004022.1|gene2794|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTTCCCTATCT
CCTTTCTATCCAACTTGACTCGTTCCAGAAGTTTATCGAGCAAGATCCTGATGGTCAAAATGGGCTGGAAGCGGCTTTCC
GTTCCGTATTTCCAATCCAAAGCTACAGCGGCAATGCTGAACTGCAATATGTCAGCTACCGCCTTGGCGAGCCTGTTTTT
GATGTTAAAGAATGTCAGATCCGTGGTGTAACTTATTCTGCACCATTACGTGTAAAACTGCGTCTGGTCATTTATGAACG
TGAAGCCCCAGAAGGCACCGTTAAAGACATCAAAGAACAAGAAGTCTATATGGGTGAAATCCCATTAATGACCGATAATG
GTACTTTTGTTATCAATGGTACTGAGCGTGTTATTGTTTCCCAGTTACATCGTAGCCCTGGTGTGTTCTTTGATAGCGAT
AAAGGTAAAACGCACTCTTCAGGTAAAGTACTGTATAACGCACGTATTATTCCTTATCGTGGTTCATGGTTAGACTTCGA
ATTCGACCCTAAAGATAATCTTTTTGTCCGTATTGACCGTCGTCGTAAATTACCAGCGACTATCATTTTACGCGCAATGA
ACTACAGCACCGAAGACATCTTAAATCTGTTCTTCGAGAAAACAACGTTTGAAATCAGTAATAATAAACTGATGATGACG
TTAGTTCCTGAGCGTCTGCGTGGTGAAACAGCTTCATTTGATATTGAAGCAAACGGCAAAGTTTATGTCGAAAAAGGTCG
CCGTATTACTGCTCGTCATATTCGTCAGTTAGAAAAAGAACAAATTGAGCGTATCGAAGTACCTGTTGAATACATCGCAG
GTAAAGTAGTGGCTCGTGACTATATTGATGAAGCGACAGGTGAATTGATTTGTGCTGCTAACATGGAAATCTCTTTAGAT
GTGTTAGCTCGCTTAAGTCAAGCTGGTCATAAAACTATCGAAACACTGTTTACCAACGATTTAGATCATGGTGCTTATAT
TTCAGAAACTATCCGCGTCGATCCTACCAACGATCGTTTAAGCGCATTAGTTGAAATCTATCGCATGATGCGTCCTGGTG
AACCACCAACTCGCGAAGCGGCAGAAAACTTATTTGAGAACTTATTCTTCTCAGAAGATCGTTATGATCTCTCTGCGGTT
GGTCGCATGAAATTCAACCGCTCTTTAGGTCGCGAAGAAGTTGAAGGTTCTGGCATCTTAAGCCAAGAAGATATCATTGA
AGTGATGAAAAAACTGATTGATATCCGTAATGGTAAAGGTGAAGTGGACGATATCGACCACTTAGGTAACCGTCGTATTC
GTTCTGTTGGCGAAATGGCTGAAAACCAATTCCGTGTTGGTCTGGTGCGTGTTGAACGTGCAGTTAAAGAGCGTCTATCT
TTAGGTGATCTTGATGCATTAATGCCACAAGATATGATCAACGCAAAACCGATTTCTGCTGCAGTTAAAGAGTTCTTTGG
CTCTAGCCAGTTATCGAAGTTTATGGATCAGAATAACCCGCTGTCAGAAATTACCCATAAACGTCGTATTTCTGCATTAG
GCCCTGGTGGTCTGACTCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCAACTCACTATGGTCGTGTGTGTCCA
ATCGAAACACCTGAAGGTCCAAATATCGGTCTGATTAACTCATTATCTGTTTATGCACAGACTAACGAGTACGGATTCTT
AGAAACGCCTTACCGTGTTGTAGAAAACAACGCTGTAACAGATGAAATCCACTATCTGTCTGCAATTGAAGAAGGTAACT
TCATCATTGCTCAGGCTAACTCCGTATTAGATGATGATGGCCACTTCGTAGAAGAATTAGTAACTTGCCGTCATAAAGGT
GAGTCAAGTTTATTTAGTCGTGATCAAGTTCAGTACATGGACGTTTCAACTCAACAGGTTGTTTCTGTCGGTGCTTCACT
GATCCCATTCCTTGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCTGTTCCTACACTTC
GTGGTGATAAACCACTGGTAGGTACAGGTATGGAACGTGCTGTAGCGGTTGACTCCGGTGTTACTGCGGTAGCAAAACGT
GGTGGTACTGTTCAGTATGTTGATGCTTCTCGTATCGTTATCAAAGTAAACGAAGATGAGACTTATGCTGGTGAAGCAGG
CATTGATATTTACAGCTTAACTAAATATACCCGCTCTAACCAAAACACATGTATTAACCAAACACCTTGTGTTTCTTTAG
GTGAACCTGTTGAACGTGGTGATGTACTTGCCGATGGTCCATCAACAGACCTTGGTGAACTTGCATTAGGTCAAAACATG
CGCGTGGCATTTATGCCATGGAATGGTTATAACTACGAGGACTCCATCCTTGTATCTGAGCGTGTTGTTCAAGAAGACCG
TTTCACAACTATCCATATTCAAGAACTTGCTTGTGTGTCTCGTGATACTAAGTTAGGGCCTGAAGAGATCACTGCAGATA
TTCCTAATGTTGGTGAAGCTGCGTTATCTAAACTGGATGAATCAGGTATCGTTTATATCGGTGCTGAAGTGAAAGGCGGT
GATATTCTGGTAGGTAAAGTAACACCGAAAGGTGAAACTCAACTGACTCCAGAAGAGAAACTGCTACGTGCTATCTTCGG
TGAAAAAGCATCTGATGTTAAAGATTCTTCTCTGCGTGTTCCTAACGGTGTATCTGGTACAGTTATTGATGTACAAGTCT
TCACCCGTGATGGCGTAGAAAAAGACAAACGTGCATTAGAAATCGAAGAATCGCAATTACGTGAAGTTAAAAAAGACTTA
ACAGAAGAGTTACGTATCTTTGAAGCGGGTCTTTTTGCACGTATTCGTGGCGTTCTGATTGCCGGCGGTATTGAAGCTGA
CAAATTAGATAAACTACCTCGTGAACGTTGGTTAGAACTGGGTCTTGCTGATGAAGAGAAGCAAAACCAGTTAGAACAAT
TAGCTGAACAGTATGATGAACTGAAAGCTGAATTCGCGAAGAAACTGGAAGCTAAGCGTCGTAAGATCACTCAAGGTGAT
GATTTAGCACCGGGTGTATTGAAGATTGTTAAGGTTTATCTGGCTGTTAAACGTCAGATCCAACCTGGTGATAAGATGGC
GGGTCGTCATGGTAACAAGGGTGTTATCTCTAAGATTAACCCAATTGAAGACATGCCATACGATGAAAACGGTAATCCTG
TTGACCTCGTACTGAACCCACTGGGTGTACCATCACGTATGAACATTGGTCAGATCCTTGAAACTCACTTGGGTATGGCT
GCTAAAGGTATCGGTGATAAAATCAATGCGATGCTGAAACAGCAACAAGAAGTGGCTAAGTTACGTGAATTTATCCAGAA
AGCTTATGATCTGGGTATGGCACCTCGTCAGAAAGTTGATTTGGACACCTTCAGTGATGAAGAAGTGTTACGTTTGGCTG
AGAACCTGAAAAAAGGTATGCCAACTGCAACACCTGTGTTCGATGGTGCAGAAGAGATGGAAATTAAAGAGATGCTGAAA
TTAGCAGATCTTCCAACTTCTGGTCAGATTACACTTTTCGATGGTCGTACAGGTGAACAATTCGAACGTCCAGTAACTGT
AGGTTACATGTACATGCTGAAACTGAACCACTTAGTTGATGACAAGATGCACGCCCGTTCTACCGGTTCGTACAGCTTAG
TTACTCAGCAACCTCTTGGTGGTAAAGCACAGTTTGGTGGACAGCGTTTCGGGGAGATGGAAGTATGGGCACTGGAAGCA
TACGGTGCGGCTTACACGCTACAAGAAATGCTTACTGTTAAGTCGGATGACGTTAACGGTCGTACCAAAATGTACAAAAA
CATTGTTGATGGTAACCATCAGATGGAACCAGGTATGCCTGAGTCGTTCAACGTATTGTTGAAAGAGATCCGTTCACTGG
GTATCAACATCGAATTGGAAGACGAATAA

>Rif|NC_007622.3792928|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GTATTACACCAGCAGATATTATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCGCAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGCGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCGGACGGACGTCCGATCGATATCATGTTAAACCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTGCATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>CARD|pvgb|AL450380|2273268-2276805|ARO:3003284|Mycobacterium|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
CTAAGCCAGATCTTCTATGGACGCCGATTCGTTGCGGGACAAGTTGATACCGAGGTTGGCCGCAGCCCGCTCGAGGTCCT
CATCCTCACCTTCGCGCAACTCGATCGCCGCACCGTCGGACGACAGCACCTCGACGTTGAGACACAGCGACTGTAACTCC
TTGAGCAGCACCTTGAACGACTCGGGGATGCCCGGCTCGGGGATGTTCTCACCCTTAACGATAGCCTCGTAAACCTTGAC
CCGACCGACGGTGTCGTCGGACTTGATGGTCAACAGCTCCTGCAGCGTGTAGGCCGCACCGTAGGCCTGCATGGCCCAGC
ACTCCATCTCACCGAATCGCTGGCCACCGAACTGTGCCTTACCACCCAACGGCTGCTGGGTAATCATCGAGTACGGGCCG
GTGGAGCGGGCGTGGATCTTGTCGTCCACCAAGTGGTGCAGCTTCATGATGTACATGTAGCCAACCGTCACCGGATAAGG
GAACGGCTCACCGCTGCGCCCATCGAAGAGCACCGCCTTGCCGTCGCCGCCCACCATCACATCGCCGTCGCGGTTGGGCA
ACGTGGAGGACAACAGGCCCTGTAGTTCCTCTTCCTTGGCGCCGTCGAACACCGGGGTCGACACGATCTGGTTGGGCGCA
GCGTGCAACAACTCCTCAGGCAAGTTGACCGCCCAATCCGGTATACCGCCGGCCACGTCGATCTTCCAGCCGGACTTGGC
TACCCACCCAAGGTGGGTTTCCAAGATCTGACCGACGTTCATCCGCCGCGGCACCCCGTGAGTGTTGAGGATGATGTCCA
CCGGGGTGCCGTCTGGCAGAAACGGCATATCCTCGGCAGGCAGGATCTTGCCGATCACGCCCTTGTTGCCGTGCCGCCCA
GCCAGCTTGTCACCGTCAGAGATCTTGCGCTTCTGGGCTACGTAGACACGGACCAGCTCGTTGACGCCGGCGGGCAGCTC
GTCGTCATCCTCATGGGAGAACACCCGAATGCCGATCACCTTGCCGGATTCGCCGTGTGGCACCTTCAGCGACGTGTCAC
GGACCTCGCGGGCCTTTTCGCCGAAGATCGCCCGCAGCAACCGCTCTTCCGGTGTCAGCTCAGTTTCCCCCTTCGGGGTG
ACCTTGCCAACCAGGATATCACCGTCACGAACCTCCGCGCCAATCCGCACGATGCCCCGCTCGTCCAAGTCGGCTAGCAC
CTCATCGGAGACGTTGGGAATGTCCCGGGTGATCTCCTCAGCACCCAGCTTGGTGTCACGGGCGTCGATCTCATGCTCCT
CAATGTGAATCGAAGTAAGCACGTCCTCTTCGACCAGTCGGTTAGACAGGATGATCGCATCCTCGTAGTTGTGACCCTCC
CACGGCATGATCGCCACCAGCAAGTTCTTGCCCAACGCCATCTCGCCGTTCTCAGTGCACGGACCGTCAGCAATCACTTG
GCCGGCCTCGACCCGATCCCCCGCATCCACGATCGGGGACTGGTTGGCGCAGGTGCCGTGGTTGGAGCGCGCGAACTTAC
GCATCCGATAAGTCCGCCGGGTGCCGTCATCGGCCATCACGGTGATGTAGTCGGCGGAAACCTCCTCGATCACCCCGGAC
TTCTCCGCAACGACGACGTGGCCAGCGTCGATGGCCGCGCGCAACTCCATACCGGTACCCACCAACGGTGCTTCGCTGCG
CACCAACGGAACCGCTTGGCGCTGCATGTTAGCGCCCATCAGGGCACGGTTGGCGTCGTCGTGCTCAAGGAACGGAATCA
TCGCTGTGGCCACCGACACCATCTGGCGTGGCGAGACATCCATGTAATCCACCTCGGACGAGGCCACGTACTCCACCTCG
CCCGCCTTGCGGCGCACCAACACGCGCGGCTCGAGGAAGCGGCCGGCCTCGTCGATCGGCGAGTTGGCCTGCGCCACGAC
ATGGCGGTCTTCCTCGTCAGCGGTCAAGTATTCGATCTCGTCGCTGACCACACCGTCAACCACTTTGCGGTACGGTGTTT
CGATGAACCCGAAGGGGTTGACCCGCGCGTACACCGACAATGAACCGATCAGACCTATGTTCGGGCCCTCCGGAGTCTCG
ATCGGGCACATCCGGCCGTAGTGCGAAGGGTGCACGTCACGGACCTCTAGCCCGGCACGCTCACGCGACAAACCACCCGG
GCCCAGCGCCGACAGCCGGCGCTTGTGGGTCAGGCCCGACAGAGGGTTGTTCTGATCCATGAACTGCGACAGCTGGCTGG
TGCCGAAGAATTCCTTGATAGCGGCGACCACCGGACGGATATTGATCAGCGTCTGCGGCGTGATCGCCTCGACGTCCTGG
GTGGTCATCCGCTCCCGGACCACCCGCTCCATCCGCGACATACCGACCCGGATCTGGTTCTGGATCAATTCGCCGACCGT
GCGCAGCCGGCGGTTGCCGAAGTGGTCGATATCGTCAGTTTCCACTGGCACTTCTACCCCACCTGGGACAGTCATTGTCG
ACTGACCCTCATGCAGACGAACCAGGTACTCTATGGTGGCGACGACATCCTCTTCGGTCAGCGTGGACGACGTGATCAAC
TCACCGGCGTGCAACCCGAGCTTCTTGTTGACCTTGTAACGACCAACCCTGGCCAGGTCGTAGCGTTTCTCCTTGAAGAA
CAGGTTCTCCAACAGCGTCTGCGCGGACTCCTTAGTCGGCGGCTCACCTGGGCGCAACTTACGATAGATGTCTAGCAGCG
CCTCGTCGGTGCCAACTGTGTTGTCCTTCTCCAGCGTCGAGCGCATGATCTCGGAGAAACCGAAACGCTCGGTGATCTGC
TCACTGGTCCAACCTAGCGCTTTGAGAAGCACCGTGACGGGTTGCCGGCGCTTCCGGTCAATGCGGACACCGACGGTGTC
GCGTTTATCGACATCGAATTCCAACCAGGCACCGCGGCTGGGAATCACCTTGACACTATGCAGCGTCTTTTCTGTGGACT
TGTCGATCGTCTCGTCGAAGTATACTCCAGGGGAGCGCACCAGCTGGCTAACGACGACACGCTCGGTCCCGTTGATGATG
AAGGTTCCCTTCTCAGTCATCATAGGGAAGTCGCCCATAAACACCGTCTGGCTCTTGATCTCCCCGGTGTTGTTGTTGAT
GAACTCGGCCGTGACGAACAGCGGGGCCGCGTACGTCATGTCCTTGTCTTTGCACTCTTCGACGGGCGCCTTGACTTCGT
CAAAACGGGGATCGGAGAAAGACAATGACATTGAGCCGGAGAAATCCTCGATCGGCGACAGCTCGTAGAGCACCTCTTCG
AGACCACCCACCGGCTTGAGATCGCCGCGGCTTGCGGCCGCTGCACGCCAGCACGGCGATCCGATCAACCACTCAAATGA
ATCAGTCTGCACATCAAGTAGCCCCGGAACCTCAAGCGGTTCGCGGAGCTTGGCAAATGAAATTCGGTTGGGCGCGCCGG
GCACGGAGTTGTTGGGCGAACTTTGGGGGCGACTCTGGCTAGGACTAACGTCTGTCTTGCTCTGGCCGAAATCTGGCAAG
ATGCATCCTTCCAGCACC

>Rif|NC_002951.3236234|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGCGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAACCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCGGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTTCGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGTACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTTATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATCGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTTGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>Rif|NC_009487.5169226|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGTACCAATCAAACCCATTATCTGATTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAACGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGAACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATCGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>Rif|NC_006582.1.3201560|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGACAGGTCAACTAATTCAGTATGGACGTCACCGCCAGCGGAGAAGCTATGCGCGAATTAATGAAGTGCTCGAACTGCC
AAACTTGATTGAAATTCAAACAGCTTCTTATCAATGGTTTCTTGATGAGGGTTTGCGGGAGATGTTTCAAGACATTTCAC
CGATCCAAGACTTCACTGGCAATTTAGTGTTAGAGTTTATTGATTACAGTCTAGGAGAACCAAAGTATCCTGTTGATGAG
TCAAAAGAGCGTGACGTGACCTTTGCCGCTCCTCTACGTGTCAAAGTTCGCCTTATTAATAAAGAGACAGGCGAAGTAAA
AGAACAGGAAGTCTTTATGGGCGATTTCCCGTTGATGACAGAAACAGGGACATTTATCATCAATGGCGCTGAGCGCGTTA
TCGTTTCTCAGCTTGTTCGCTCACCGAGCGTTTACTATAGCCAAAAGCTCGACAAAAACGGAAAAAAAGGCTTTACTGCC
ACTGTCATTCCGAACCGCGGAGCGTGGCTTGAGCTTGAGACAGATGCAAAAGATATTGTTTATGTACGTATTGACCGTAC
TCGTAAAATTCCAGTTACAGTACTTTTGCGTGCTCTAGGCTTTGGGTCTGATCAAGAAATCGTTGACCTTTTAGGCGAAA
ACGAGTATTTGCGCAACACGCTAGAGAAAGACAATACGGATTCAACCGATAAAGCGCTGCTTGAAATCTATGAGCGTTTG
CGCCCAGGCGAGCCGCCAACAGTAGAAAATGCGAAAAGCTTGCTTGAATCTCGCTTTTTCGATCCTAAGCGTTATGACCT
CGCAAATGTCGGTCGTTATAAAATAAATAAAAAGCTTCATATCAAAAATCGGCTATTTAACCAACGTTTGGCGGAAAAGC
TTGTTGATCCGGAGACAGGCGAAGTTCTAGCTGAAGAGGGAACACTGCTTGACCGGAGAACGTTGGATAAACTGATCCCG
CATTTGGAGAAAAATGTTGGTTTCCGTACAGCCCGTACATCTGGCGGCGTTCTTGAGGAATCCGACGTCGAAATCCAATC
GGTTAAAATTTATGTAGCAGATGACTATGAGGGCGAGCGCGTCATTTCCGTTATTAGCAACGGCATGGTTGAACGCGACG
TAAAACATATTGCCCCTGCGGATATCATCGCTTCCATCAGCTATTTCTTCAACTTGCTGCATGGTGTCGGCGATACAGAC
GACATTGACCATTTGGGCAACCGCCGTCTCCGTTCGGTTGGGGAACTGCTGCAAAACCAATTCCGAATTGGCCTTTCTCG
GATGGAACGCGTCGTGCGTGAACGGATGTCCATTCAAGACCCGAATGTGATTACGCCACAAGCGCTTATTAACATTCGCC
CAGTCATCGCATCGATTAAAGAGTTCTTTGGTAGCTCGCAGCTTTCACAGTTCATGGACCAAACGAACCCACTTGCTGAA
CTGACGCATAAGCGCCGACTTTCTGCGCTAGGCCCAGGAGGTTTAACTCGTGAGCGTGCTGGAATGGAAGTACGTGACGT
TCACTATTCCCATTACGGGCGGATGTGTCCGATTGAAACGCCGGAAGGCCCGAACATTGGCTTGATTAACACGCTGTCCT
CTTACGCGAAAGTGAATGAGTTCGGTTTTATGGAAACACCATACCGCCGTGTTGACCCTGAAACAGGGAAAGTAACATCG
CGAATCGACTATTTAACAGCCGATGAAGAGGACAATTATGTAGTTGCCCAAGCCAATGCGAAGCTGAATGATGACGGATC
GTTTGTCGATGATAACATCATTGCCCGCTTCCGCGGTGAAAACACCGTCGTTCCTTGCGACCGTGTCGACTATATGGACG
TTTCGCCTAAACAAGTTGTTTCTGCGGCGACGTCATGTATTCCGTTTTTGGAAAATGACGACTCGAACCGCGCACTAATG
GGCGCAAACATGCAGCGCCAAGCCGTGCCTTTGCTCGTTCCAGAAGCACCGCTTGTCGGAACAGGGATGGAGCACGTGTC
TGCTAAAGATTCAGGGGCTGCCGTTGTCTCAAAATATGCCGGTATCGTTGAACGTGTTACTGCTAAAGAAATTTGGGTCC
GCCGCATCGAAGAAGTAGATGGCAAAGAAACGAAAGGCGACCTTGATAAATACAAACTACAAAAATTTGTGCGCTCCAAC
CAGGGCACAAGTTATAATCAGCGCCCGATTGTACGCGAAGGCGATCGCATTGAAAAACGTGAAATCTTAGCAGATGGTCC
TTCAATGGAGATGGGCGAAATGGCGCTTGGCCGCAACGTGCTTGTCGCCTTTATGACATGGGATGGCTACAACTACGAGG
ATGCGATCATTTTAAGTGAGCGCCTTGTCAAAGATGACGTTTATACGTCCATCCATATCGAGGAATATGAATCGGATGCC
CGTGATACAAAACTCGGACCTGAAGAGATTACACGCGATATTCCGAACGTTGGTGAGGATGCATTACGCAACCTTGACGA
GCGGGGAATTATTCGCATCGGGGCTGAAGTTAAAGATGGCGACATTCTTGTTGGTAAAGTAACGCCAAAAGGTGTAACAG
AGCTGACGGCAGAAGAACGCCTCTTGCACGCGATTTTTGGAGAGAAAGCCCGTGAAGTGCGGGATACTTCATTGCGTGCA
CCGCATGGTGGAGACGGAATCGTTCTTGACGTGAAAATCTTTAACCGTGAAGACGGCGATGAACTTCCTCCAGGCGTCAA
CCAACTTGTCCGTGTCTACATCGTACAAAAGCGGAAAATTAACCAAGGCGATAAAATGGCTGGCCGTCACGGGAACAAAG
GGGTTATTTCCCGAATCCTGCCAGAAGAAGATATGCCGTTTTTACCAGATGGAACGCCTGTTGACATTATGTTAAACCCA
CTTGGCGTACCTTCGCGGATGAATATCGGACAAGTGCTTGAACTTCATCTTGGTATGGCTGCCCGCAAACTAGGCATCCA
TGTGGCGTCTCCAGTATTTGACGGCGCTAGTGAAGAAGACGTTTGGGGCACATTGGAAGAAGCAGGCATGGCCCGAGACG
GAAAAACGATTTTATATGATGGCCGTACTGGCGAACCGTTTGACAATCGTGTATCTGTTGGGATTATGTACATGATCAAG
CTTGCCCACATGGTTGACGACAAGCTCCATGCCCGGTCAACAGGCCCGTACTCACTCGTTACGCAGCAGCCTCTTGGCGG
TAAAGCTCAATTTGGTGGACAGCGTTTCGGGGAAATGGAAGTATGGGCACTGGAAGCATACGGTGCTGCTTACACGCTCC
AAGAAATTCTCACTGTTAAATCAGATGACGTTGTTGGTCGTGTGAAAACGTACGAGGCAATTGTAAAAGGGGAAAACGTT
CCTGAGCCAGGGGTGCCGGAATCGTTTAAAGTCCTCATTAAAGAATTGCAATCGTTGGGCATGGACGTGAAGATGCTCTC
CAGCAACGAAGAAGAAATTGAAATGCGCGAGCTGGATGACGAAGAAGACCAAACGTCTGAAAAACTCAACCTCAATTTAG
AGACGAACGAATCACAACTATAA

>CARD|pvgb|NC_002952|590830-594382|ARO:3003285|Staphylococcus|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGAGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GTATTACACCGGCAGATATCATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTGCGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTTTAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGACACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATTGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAAT

>Rif|CP001138.1|gene4362|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTACCTTATCT
CCTTTCTATCCAGCTTGACTCGTTTCAGAAGTTTATCGAGCAAGATCCTGAAGGGCAGTACGGCCTGGAAGCAGCCTTCC
GTTCCGTGTTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAGTACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTTCAGGAATGTCAGATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTAAAACTGCGTCTGGTGATCTACGAGCG
CGAAGCGCCGGAAGGCACCGTTAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACCGACAACG
GTACCTTTGTTATCAACGGTACTGAGCGTGTTATTGTTTCTCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGAC
AAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGCATCATTCCTTACCGTGGTTCCTGGCTGGACTTCGA
ATTCGATCCGAAGGACAACCTGTTCGTGCGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATCCTGCGTGCGCTGA
ACTACACCACTGAGCAGATCCTTGACCTGTTCTTTGAGAAAGTGGTCTTCGAAATTCGCGACAACAAGCTGCAGATGGAG
CTGATTCCAGAACGTCTGCGCGGCGAAACCGCGTCGTTCGATATCGAAGCTAACGGCAAAGTGTACGTTGAAAAAGGCCG
TCGCATTACCGCGCGTCACATCCGTCAGCTGGAAAAAGACGATATCAAGCATATCGAAGTTCCGGTTGAGTACATCGCAG
GTAAAGTCGTCTCTAAAGACTACGTTGACGAATCCACTGGCGAGCTGATCTGCGCGGCGAACATGGAGCTGAGCCTGGAT
CTGCTGGCTAAGCTGAGCCAGTCCGGCCACAAGCGTATCGAAACGCTGTTTACCAACGATCTGGACCACGGCCCGTACAT
TTCTGAAACGGTACGCGTCGACCCAACCAACGATCGTCTGAGCGCGCTGGTAGAAATCTACCGCATGATGCGCCCTGGTG
AGCCGCCGACACGCGAAGCGGCTGAAAGCCTGTTCGAGAACCTGTTCTTCTCCGAAGACCGCTATGACCTGTCTGCGGTG
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGACGAAATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATTGA
TGTCATGAAGAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTGGATGATATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTCGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTGCGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAAGCCGATTTCCGCCGCAGTGAAAGAGTTCTTTGG
TTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCG
GCCCAGGCGGTCTGACTCGCGAACGCGCAGGCTTCGAAGTTCGAGACGTACACCCGACGCACTACGGTCGCGTATGTCCT
ATCGAAACGCCGGAAGGTCCGAACATCGGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATATGGCTTCCT
TGAGACGCCGTACCGTCGTGTGGTTGATGGCGTGGTCACTGACGAAATTCATTACCTGTCTGCTATCGAAGAAGGCAACT
ACGTTATCGCTCAGGCGAACTCCAACCTGGATGACGAAGGCCACTTTGTAGAAGATCTGGTGACCTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGTGACCAGGTTGACTACATGGACGTTTCCACCCAGCAGGTGGTCTCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCGGTTCCGACTCTGC
GTGCTGACAAGCCGCTGGTGGGTACCGGTATGGAACGTGCTGTCGCCGTCGACTCCGGTGTTACTGCAGTAGCTAAACGT
GGCGGTACTGTTCAGTACGTGGATGCGTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTACCCGGGCGAAGCGGG
TATCGACATCTATAACCTGACCAAATACACCCGCTCTAACCAGAACACCTGTATCAACCAGATGCCATGTGTGTCTCTGG
GCGAGCCGGTTGAACGCGGCGACGTGTTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTCGGTCAGAACATG
CGAGTGGCGTTCATGCCGTGGAACGGCTACAACTTCGAAGACTCCATCCTCGTTTCCGAGCGTGTTGTCCAGGAAGACCG
TTTCACCACCATCCACATTCAGGAACTGGCGTGCGTGTCCCGTGACACCAAGCTGGGGCCGGAAGAGATCACCGCTGACA
TCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTACATCGGCGCGGAAGTAACCGGCGGC
GACATTCTGGTCGGTAAGGTGACGCCGAAAGGTGAAACCCAGCTGACGCCGGAAGAGAAACTGCTGCGTGCGATCTTCGG
TGAGAAAGCGTCTGACGTTAAAGACTCTTCTCTGCGCGTACCTAACGGTGTCTCCGGTACGGTTATCGACGTTCAGGTCT
TTACTCGCGATGGCGTAGAAAAAGACAAACGTGCTCTGGAAATCGAAGAGATGCAGCTCAAGCAGGCGAAAAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGCCTGTTTAGCCGTATCCGTGCGGTACTGGTGTCCGGCGGCGTTGAAGCTGA
GAAGCTCGACAAACTGCCGCGCGACCGCTGGCTGGAACTCGGTCTGACCGACGAAGAGAAACAAAATCAGCTGGAACAAC
TGGCTGAGCAGTATGACGAGCTGAAACACGAGTTCGAGAAAAAACTTGAAGCGAAGCGCCGTAAAATCACCCAGGGCGAC
GATCTGGCGCCGGGCGTGCTGAAGATCGTGAAGGTCTATCTGGCCGTTAAACGCCGTATCCAGCCGGGTGATAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTTATCTCTAAGATCAACCCGATCGAAGACATGCCTTACGATGAAAACGGCACGCCGG
TCGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATTCTGGAAACCCACCTGGGTATGGCT
GCAAAAGGTATTGGCGACAAGATTAACGCCATGCTGAAACAGCAGCAGGAAGTCGCGAAACTGCGCGAATTCATCCAGCG
TGCCTACGATCTGGGCGCCGACGTTCGTCAGAAAGTCGACCTGAGCACCTTCAGCGATGATGAAGTGCTGCGTCTGGCAG
AAAACCTGCGTAAAGGTATGCCGATTGCCACACCAGTGTTTGACGGTGCGAAAGAAGCGGAAATCAAAGAGCTGCTGAAA
CTGGGCGACCTGCCGACCTCCGGTCAGATCACCCTGTTCGATGGCCGTACGGGTGAACAGTTCGAACGTCCGGTAACCGT
CGGTTACATGTACATGCTGAAACTGAACCACCTGGTTGATGACAAGATGCATGCGCGTTCTACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCGCAGTTCGGTGGTCAGCGCTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCT
TACGGCGCCGCCTACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACCAAGATGTATAAGAA
CATCGTGGACGGCAACCATCAGATGGAACCGGGTATGCCGGAATCCTTCAACGTTCTGTTGAAAGAGATCCGCTCGCTGG
GCATCAACATCGAACTGGAAGACGAGTAA

>Rif|NC_012491.1.7717716|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTAAAGTGATTCAAAGTGGCCGACACCGCCAGCGTCGTACGTATTCACGTATTAACGAAGTGCTGGGCCTTCC
AAATCTCATCGAGATTCAACAAAAGTCCTACCAATGGTTCCTTGATGAGGGGCTCCGTGAGATGTTCCAAGACATTTCGC
CAATCCAGGACTTCACAGGTAATCTCGTGCTGGAGTTTATCGACTACAGCTTGGGAGAGCCGAAGTACGATGTTGACGAG
TCGAAAGAACGTGACGTCACCTATGCGGCGCCTCTGCGTGTGAAGGTACGTTTGTTGAACAAAGAGACGGGTGAAGTGAA
GGAACAAGAAGTATTCATGGGGGATTTCCCGCTCATGACAGAAACGGGAACCTTCATTATTAATGGTGCTGAGCGCGTAA
TTGTCAGCCAGCTTGTTCGTTCCCCCAGTGTATATTACAACACCAAAGTGGACAAAAACGGCAAGCAGACGTTTACAGCT
ACAGTAATCCCGAACCGGGGTGCTTGGCTGGAGCTGGAGACCGATGCGAAGGACGTTATTTATGTCCGCATCGACCGTAC
GCGAAAAATCCCGGTAACGGTTCTTTTGCGTGCGTTGGGCTTTGGTTCCGACATTGAGATTCTCAACTTGCTGGGTGAAG
ATGAATACATCAAGAACACGCTGGAAAAAGACAATACGGATTCTACGGAAAAAGCGCTCATCGAAATCTACGAGCGTCTT
CGTCCGGGTGAGCCACCAACAGTCGAAAATGCGAAGAGCCTCTTGATCTCTCGTTTCTTCGACCCTAAGCGCTATGATTT
GGCTTCTGTTGGTCGCTATAAAATGAACAAAAAGCTTCATTTGAAAAACCGTCTGTACAACCAACGTCTGGCTGAAACGT
TGATCGATACGACAACAGGTGAAATTTTTGCCGAAGCAGGTCAAATGATTGACCGTCGTGTGTTGGAACGTATTGTGCCA
GCTCTGGAAGGCAGCATCGGATTTATCGACGTTCGCACGCATGGCGGCGTTCTGGAAGATGAAGCAATCCATCTACAATC
TATCAATATTTTTTCTCCGATTGAAGATGGCAAGATCATCAAAGTAATCGGAAACGGAAATGTAGATAAGTCCTTCAAAC
ATATTACGCCGGCGGACATCGTATCGGCGATCAACTATTTCATGAACCTGCTGCACAGTGTAGGCTCCACAGATGATATC
GACCACTTGGGTAACCGTCGTCTGCGTTCCGTAGGTGAACTGTTGCAGAACCAGTTCCGTATTGGTCTGTCCCGTATGGA
GCGTGTGGTTCGTGAGCGCATGTCCATCCAGGATCAAAACCAAATTACACCGCAAGCTCTCATTAACATCCGTCCAGTGA
TTGCCTCGCTGAAGGAGTTCTTTGGTAGCTCGCAGTTGTCCCAGTTCATGGATCAAACAAATCCATTGGCTGAGCTGACG
CACAAACGCCGTTTGTCCGCACTCGGACCTGGTGGTTTGACGCGTGAGCGCGCGGGCTTCGAAGTGCGCGACGTTCACCA
TTCCCACTACGGTCGTATGTGTCCAATTGAGACGCCAGAGGGACCAAACATTGGTTTGATCAACTCCCTGTCGTCCTTTG
CACGCATTAACGATTACGGATTCATCGAAACGCCGCGTCGTAAAGTAGATCCAGAAACAGGCTTCGTGTTGACTGATATC
AGCTACTTGACTGCTGATGAGGAAGACGTGTTCAACGTGGCACAGGCGAATCAGCCACTTGATGAAGATGGCCGTTTCGT
AAACGACATGGTAATCTGCCGTCGTAAAGGTGAGATCTTGAGCGTACCGCGCGACAAGGTAGACTTCATGGACGTATCGC
CGAAGCAGGTTGTATCCGTTGCGACAGCGCTGATTCCGTTCCTCGAGAACGATGACGCCAACCGCGCACTGATGGGTTCA
AACATGCAGCGGCAGGCCGTTCCGCTTTTGATTCCACAAGCACCGTTTGTCGGTACGGGTATGGAACATAAAGCAGCGCA
AGACTCCGGGGTGGCGATCGTTGCCAAGCATCCGGGTCAAGTTGAGCGCGTAACGGCTCGCGAAATCTGGATTCGTCGTT
ACCAAGAAATCGATGGCAGAAAAGTTGCTGGCGATCTCGATAAATACAAAATGCACAAGTTTATCCGTTCCAACCAAGGT
ACCTGCATCAACCAGCGTCCAATTGTAAGCACTGGAGACTGGATTGAAAAAGGCGATATCGTTGGGGACGGCCCATCCAC
TGAAAAAGGTGAATTGGCTCTCGGTCGTAACGTAATCGTTGCGTTTATGACGTGGGAAGGATACAACTACGAAGACGCGA
TTCTTCTAAGTGAAAAACTTGTAAAAGATGACGTGTATACGTCTATTCATATTGAAGAATACGAGTCCGAAGCTCGCGAC
ACCAAGCTGGGTCCAGAGGAAATCACTCGCGATATTCCAAACGTCGGGGAAGATGCTCTGAAAAACCTGGACGAACGCGG
TATCATCCGTGTTGGTGCGGAGATTCAGGACGGCGACATTCTCGTTGGTAAGGTTACACCTAAAGGGGTTACTGAGCTGA
CAGCAGAAGAACGCCTCCTGCATGCCATCTTCGGTGAAAAAGCTCGTGAAGTTCGTGATACATCCCTGCGCGTACCGCAT
GGTGGTTCCGGTATCATCGTAGACGTAAAAGTATTTACGCGTGAGAATGGCGACGAATTGCCACCAGGCGTAAACCAACT
CGTTCGCGTTTACATCGCCCAAAAACGGAAAATCTCCGTGGGTGACAAAATGGCTGGTCGACATGGTAACAAAGGGGTTA
TCGCCCGCATCATGGCGGAAGAAGATATGCCATTCCTGCCAGATGGTTCTCCAGTAGAGATCGTACTCAACCCGTTGGGC
GTACCTTCGCGTATGAACATCGGTCAGGTATTGGAGACTCACTTGGGTATGGCAGCGAAGCTTCTGGGTATCCACGTAGC
AACCCCGGTATTTGACGGTGCACGTCAGGCAGAAGTATTCGAAACGTTGGCAGAAGCAGGTCTGGATCGTGACGGAAAAA
CGATCTTGTTTGATGGTCGTACTGGTGAACCGTTTGATCGCCGTGTAACAGTTGGTTGTGTATACATGCTGAAACTGGCT
CACTTGGTTGACGATAAAATCCATGCTCGTTCTACTGGTCCTTACTCTCTTGTTACGCAGCAACCATTGGGTGGTAAAGC
TCAATTCGGTGGACAGCGTTTCGGGGAGATGGAGGTTTGGGCATTGGAAGCATACGGTGCTGCCTACACCTTGCAAGAAA
TTCTTACTGTCAAGTCGGATGACGTCGTGGGCCGCGTGAAAACGTACGAAGCGATCGTTAAGGGCGAAAACGTTCCAGAA
CCAGGTGTTCCAGAGTCCTTCAAGGTATTGATCAAGGAACTGCAGAGCTTGGGTATGGACGTGAAGATTCTGTCCGGTGA
CGAGCAGGAGATTGAAATGCGTGAAATGGAAGATGAGGATGAAGGTAACGGTGAAAAACTGAACCTCGTTCTCGAAGGCG
GAAGCTTGAACGAAGAGTAA

>Rif|NC_002163.1.904806|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGTGCGATATGTTAGATAATAAATTAGGAAATCGTTTAAGAGTAGACTTCTCAAACATTTCAAAACAAATAGAAATCCC
AAATCTTCTACAATTACAAAAAAAGAGTTTTGATTATTTTTTAAATCTTGATAATGGTGAAAGTGGTATAGAAAAAGTTT
TTAAATCAATTTTTCCTATTCATGATCCGCAAAATAGATTGAGTCTTGAATATGTTAGTAGTGAAATAGGCAAGCCAAAA
TATACCATTCGCGAATGCATGGAAAGAGGTTTGACTTATTCTGTAAATTTAAAAATGAAAATCCGTCTTACTCTGCATGA
AAAAGATGAAAAAACAGGGGAAAAAGTTGGCGTAAAAGATATTAAAGAACAAGAAATTTATATCCGCGAAATTCCTTTAA
TGACAGATCGTGTATCTTTTATCATTAACGGGGTTGAGAGAGTGGTTGTAAATCAATTACATAGAAGCCCTGGTGTTATT
TTTAAAGAAGAAGAAAGTTCAACGGTTGCAAATAAGCTTGTTTATACAGCACAAATTATTCCTGATCGTGGTTCGTGGCT
TTATTTTGAATACGATGCCAAAGATGTTTTGTATGTAAGAATCAATAAGCGTAGAAAAGTTCCTGTAACTATGCTTTTTA
GAGCTTTAGGGTATAAAAAACAAGATATTATTAAGTTGTTTTATCCTATTCAGACTATACATGTGAAAAAAGATAAATTT
TTAACAGAATTTAATCCAAATGATTTTATGGATAGAATAGAATATGATATTAAAGATGAAAAAGGAAAAATCGTTCATCA
AGCTGGAAAAAGACTTACAAAGAAAAAAGCAGAACAGCTTATTAAAGACGGTTTAAAATGGATAGAATATCCTGTAGAAA
TTTTACTTAATCGTTATTTAGCAAATCCTATTATTGATAAAGAAAGTGGAGAGGTTTTATTTGATTCTTTAACTTTGTTA
GATGAGAGTAAGCTTGCTAAGATTAAAGAGCAAAAAAGTTTTGATATAGCAAATGACTTGGCTAATGGCGTTGATGCAGC
GATTATTAACTCCTTTGCCCAAGATGGAGAAACTCTAAAACTTCTTAAACAAAGTGAAAATATCGATGATGAAAATGATT
TAGCTGCGATTAGAATTTACAAAGTTATGCGCCCAGGTGAACCTGTGGTAAAAGATGCAGCGAAGGCTTTTGTAAATGAT
TTATTCTTCAATCCTGAAAGATACGATCTTACCAAGGTAGGTCGTATGAAAATGAACCATAAATTAGGTCTTGAAGTACC
TGAGTATGTTACTGTTTTGACTAATGAAGATATTATTAAAACTGCAAAATATTTAATTAAAGTAAAAAATGGTAAAGGAC
ATATTGATGATAGAGATCATTTAGGAAATCGTCGTATCCGTTCTATAGGTGAACTTTTAGCCAATGAACTTCATTTAGGT
CTTGCAAAAATGCAAAAGGCGATCAGAGATAAATTTACTTCTTTAAATGCGGATCTTGATAAAGTAATGCCTTATGATTT
AATCAATCCTAAAATGATTACTACAACTATCATTGAATTTTTTACAGGAGGTCAGCTTTCGCAATTTATGGATCAAACCA
ACCCTTTAAGCGAGGTTACTCATAAGCGTCGTTTGTCAGCGCTTGGTGAAGGTGGACTTGTAAAAGAAAGAGCAGGTTTT
GAAGTGCGTGATGTTCACGCGACACATTATGGTAGAATTTGTCCAGTTGAAACACCTGAAGGTCAAAATATTGGTTTGAT
TAACACTCTTTCTACTTATGCAAAAGTAAATGAACTTGGCTTTGTTGAAGCGCCATATAGAAAAGTTGTAAATGGTAAAG
TGACTAATGAAGTTGTTTATCTTACAGCGACACAAGAAGAAGGCTTGTTTATCGCACCAGCTTCAACTAAGGTTGATGCT
AAAGGCAATATAGTAGAAGAATTTGTTGAGGCTAGGCAAGATGGTGAAACTATACTTGCAAGACGCGAAGAAGTGCAATT
AATCGATCTTTGCTCAGGTATGGTTGTTGGAGTTGCAGCTTCTTTGATTCCGTTTTTAGAGCACGATGATGCAAACAGAG
CGCTAATGGGTTCAAACATGCAACGTCAAGCTGTGCCACTTCTTACTGCTTCAGCTCCGATAGTAGGAACAGGTATGGAA
CAAATTATTGCGCGTGATGCTTGGGAAGCTGTTAAAGCAAAGCGTGGCGGTGTGGTTGAGAAAGTGGATAATAAAAGCAT
TTTCATTTTAGGTGAAGATGATAAAGGTCCATTTATTGACCATTACACTATGGAGAAAAATTTAAGAACCAATCAAAATA
CAAATTATATTCAACACCCTATTGTTAAAAAAGGTGATATAGTAAAAGCAGGACAAATTATCGCAGATGGTCCTTCTATG
GATCAAGGCGAACTTGCTATAGGTAAAAATGCTTTAATCGCTTTTATGCCTTGGAATGGTTATAACTATGAGGATGCTAT
AGTTGTAAGTGAGAGAATTATTCGTGAAGATACTTTTACAAGCGTGCACATTTATGAAAAAGAAATTGAAGCAAGAGAAC
TAAAAGACGGTATAGAAGAAATTACCAAAGATATTCCAAATGTAAAAGAAGAAGATGTTGCGCATCTTGATGAGAGCGGT
ATTGCAAAAATTGGTACCCATATCAAACCAGGTATGATTTTGGTGGGTAAGGTTTCTCCAAAAGGTGAGGTTAAACCAAC
TCCTGAAGAAAGACTTTTAAGAGCGATTTTTGGAGAAAAAGCAGGACATGTTGTGAATAAATCCCTTTATGCAACCGCTT
CTTTAGAGGGTGTTGTTGTGGATGTTAAAATTTTCACTAAAAAAGGCTATGAAAAAGATGATCGCGCAATAAAATCTTAT
GATAAAGAAAAAATGGCTTTAGAAAAAGAGCATCATGATAGACTTTTGATGATGGATAGAGAAGAAATGCTTCGTGTTTG
TGCTCTTCTTTCCAAAGCCTCTTTAAATAGCGATCAAAAAATTGGAGATAAAAATTATAAAAAAGGACAAACTGCAGATA
TTAGCGAACTTGAAAAAATCAATCGTTTTACTTTAACAACTTTGATTAAAGCTTATTCTAAAGAGATTCAAAAAGAATAC
GATGATTTAAAAAATCATTTCCAAAATGAGAAGAAAAAATTAAAAGCAGAACACGATGAAAAGCTTGAAATTTTAGAAAA
AGATGATATTTTACCAAGTGGGGTAATTAAGCTTGTTAAAGTTTATATTGCTACAAAAAGAAAGCTTAAAGTCGGTGATA
AAATGGCAGGACGTCATGGAAATAAAGGTATAGTTTCAACTATAGTTCCTGAAGTAGATATGCCTTATTTGCCAAATGGT
AAGAGCGTGGATATTGCGCTTAATCCACTTGGCGTTCCAAGTCGTATGAATATAGGTCAAATTTTAGAAAGTCATTTAGG
TTTAGTTGGACTTAGACTTGGGGATCAAATTCAAGAAATTTTTGATAGAAAGCAAAAAGATTTTCTTAAAGAATTAAGAG
CGAAAATACTTGAAATTTGTTCTATTCCAAGACTTGCAAACGAAAAAGAATTTATTAAAAGCTTAAGCGATGAAGAGCTT
TTAAACTATGCTAGAGACTGGAGTAAAGGAGTTAAATTTTCTACTCCTGTTTTTGAAGGTGTAAATATAGAAGAATTTAG
CAAGCTTTTTAAAATGGCTAAGATAGATATGGATGGCAAAACAGAACTTTATGATGGACGCACGGGGGAAAAAATTGCAG
AGCGTGTTCATGTAGGATGTATGTATATGCTAAAACTCCATCACTTGGTTGATGAAAAAGTTCATGCAAGAAGTACAGGA
CCTTATAGCTTGGTTACCCAACAACCTGTGGGTGGTAAAGCACTCTTTGGGGGACAAAGATTTGGAGAAATGGAAGTTTG
GGCACTTGAAGCTTATGGAGCGGCTCACACTTTAAGAGAAATGTTAACCATAAAATCAGATGATGTAGAAGGTAGATTTA
GTGCCTATAAAGCATTGACAAAAGGTGAAAATGTTCCAGCAACAGGAATTCCTGAAACATTTTTTGTATTAACCAATGAG
CTTAAATCTCTTGCTTTAGATGTTGAGATTTTTGATAAGGATGAAGATAATGAGTAA

>Rif|CP002695.1|gene18|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGCCTTACTCGTACACCGAAAAAAAGCGCATCCGCAAAAGCTTTGCCAAACGTGAGGACGTTCAAAACGTTCCCTTCCT
GTTGGCGACACAGCTTCAATCCTACCTAACTTTCCTGCAAGCCGACACCGCGACCTCGGATCGCGTCAATGAAGGTCTGC
AGGCGGCGTTCTCGTCGATTTTTCCGATTGTCAGCCATAACGGAATGGCGCGCTTGGAGTTCGTCAGCTATGCGCTGGGC
GAGCCGGTGTTTGATGTCAAGGAATGTCAGCAGCGCGGCCTGACCTATGCGTCGCCGCTGCGCGCCAAGGTGCGCCTGGT
GCTGCTGGACCGCGAAGTCAGCAAGCCGACCATCAAGGAAGTCAAGGAGCAGGAAGTCTACATGGGCGAAATTCCGCTCA
TGACCGGCACCGGCTCGTTCGTCATCAACGGCACCGAGCGCGTCATCGTCTCGCAGCTGCATCGTTCGCCGGGCGTGTTC
TTCGAGCACGACCGCGGCAAGACGCACAGCTCGGGCAAGCTGCTGTTCTCGGCCCGCGTGATTCCCTACCGCGGCTCGTG
GCTGGACTTCGAATTCGATCCCAAGGACGTGCTGTTCTTCCGCGTGGACCGTCGCCGCAAGATGCCGGTGACGATCCTGC
TGAAGGCCATCGGCATGACGCCCGAATCGATCCTCGCGCACTTCTTCGATTTCGACAACTTCGAACTCAAGAGCGAAGGC
GGCATGATGGAATTCGTCGCCGAACGCTGGAAGGGCGAGATGGCGCGCTTTGACATCGCCGACCGCGACGGCAAGGTGAT
CGTCGAGAAGGACAAGCGTATCAACGCCAAGCACCTGCGCGACCTGGCTGCCGGCGGCATCCAGCGCGTGTCGGTGCCCG
AGGATTTCCTGTACGGCCGCGTGCTGGCCAAGAACATCGTCGATCCCGACACCGGCGAAGTCGTGGCGCATGCCAACGAC
GAGATCACCGAAAGCGTGCTCAACGCGATGCGCGCCGCCAACGTGCGCGACATCCAGACGCTGTACACCAACGACCTGGA
TCGCGGTCCCTACATTTCGCAGACGCTGCGCGCCGACGAAACCGCCGACCAGATGGCCGCGCGCGTGGCGATCTACCGCA
TGATGCGTCCTGGCGAACCGCCCACCGAAGAAGCGGTGGAAGCGCTGTTCCAGCGTCTGTTCTACAGCGAAGAGACGTAC
GACCTGTCGCGCGTGGGCCGCATGAAGGTCAACAGCCGCCTGGGTCGCGGCGACGACAGCACCGGTCCGATGACGCTGAC
CAACGAGGACATCCTCGAAACCATCAAGGTGCTGGTCGAGCTGCGCAACGGCCGTGGCCAGATCGATGACATCGATCACC
TGGGCAACCGCCGCGTGCGTTGTGTCGGCGAACTGGCCGAGAACCAGTTCCGCGCTGGCCTGGTGCGTGTCGAGCGCGCC
GTCAAGGAGCGTCTGGGCCAGGCCGAGACCGAAAACCTGATGCCGCACGACCTGATCAACTCCAAGCCGATCTCGGCCGC
CATCAAGGAGTTCTTCGGTTCGAGCCAGCTGTCGCAGTTCATGGACCAGACCAACCCACTGTCGGAAATCACGCACAAGC
GTCGCGTTTCCGCACTGGGCCCGGGCGGCCTGACGCGCGAACGCGCCGGCTTTGAAGTGCGCGACGTGCACCCGACCCAC
TACGGCCGCGTCTGCCCGATCGAAACGCCGGAAGGCCCGAACATCGGCCTGATCAACTCGATGGCGCTTTACGCGCGCCT
GAACGAGTACGGCTTCCTGGAAACCCCGTATCGCAAGATCATCGACGGCAAGGTCAGCGACCAGATCGACTACCTGTCGG
CCATCGAGGAAAGCCACTACGTGATCGCGCAGGCCAACGCCGCGCTCGATGACGAAGGCCGTTTCGTCGACGACCTGGTG
GCTTGCCGCGAAGCGGGCGAAACCATGCTGACCGCGCCGGGCAACGTGCACTACATGGACGTGGCGCCGTCGCAGATCGT
GTCGGTCGCGGCGTCGCTGATCCCGTTCCTCGAGCACGACGACGCCAACCGTGCACTGATGGGCGCCAACATGCAGCGCC
AGGCCGTGCCTTGCCTGCGTCCGGAAAAGCCGCTGGTCGGCACCGGCGTCGAGCGCACCGTTGCGGTCGACTCGGGCACG
ACCGTGCAGGCGCTGCGTGGCGGCGTGGTTGACCACGTCGACGCCGACCGCGTCGTGATCCGCGTCAACGACGAAGAGAA
CGTCGCTGGCGAAGTGGGCGTGGACATCTACAACCTGATCAAGTACACGCGTTCCAACCAGAACACGAACATCAACCAGC
GTCCCATCGTGGCCCGCGGCGACAAGGTCGCCAAGGGTGACGTGCTGGCCGACGGCGCGTCCACCGACCTCGGTGAACTC
GCGCTGGGCCAGAACATGCTGATCGCGTTCATGCCCTGGAACGGCTACAACTTCGAAGACTCGATCCTGATCTCCGAACG
CGTCGTGGCCGACGATCGCTACACCTCGATCCACATCGAAGAGCTGACCGTGGTCGCTCGCGATACGAAGCTGGGACCCG
AGGAAATCACGCGCGACATCAGCAACCTGGCTGAAACGCAGCTCAACCGCCTGGATGACTCCGGCATCGTCTACATTGGC
GCGGAAGTCAGCGCCGACGACGTGCTGGTGGGCAAGGTCACGCCGAAGGGCGAAACCCAGCTCACGCCGGAAGAAAAGCT
GCTGCGCGCCATCTTCGGCGAAAAGGCTTCCGACGTTAAGGACACCTCGCTGCGCGTGCCCTCGGGCATGACCGGCACGG
TGATCGACGTGCAGGTGTTCACGCGCGAAGGCATCGTGCGCGACAAGCGCGCCCAGTCCATCATCGACGATGAACTGCGC
CGTTATCGCCAGGACCTCAACGACCAGCTGCGCATCGTCGAGAACGACCAGTTCGACCGTATCGAGAAGATGCTGGTCGG
CAAGACCGTCAATGGCGGCCCGCGCAAGCTGGCCAAGGGCGCCACCTTGACCAAGGCCTACCTGGCCGACCTGGATCGCT
GGCAGTGGTTCGACATCCGCCTGGCCGACGAACAGCACGCTGTCGTGCTGGAGCAGGCCAAGGAATCGCTCGAGCAGAAG
CGCCACCAGTTCGACCTGGCCTTCGAAGAGAAGCGCAAGAAGCTGACGCAGGGCGACGAACTGCCGCCGGGCGTGCTGAA
GATGATCAAGGTCTACCTGGCCGTCAAGCGCCGCCTGCAGCCGGGCGACAAGATGGCCGGCCGCCACGGCAACAAGGGCG
TGGTTTCGCGCATTACGCCGGTCGAGGACATGCCCCACATGGCCGACGGCACTCCCGCCGACATCGTTCTGAACCCGCTG
GGCGTGCCCTCGCGGATGAACGTCGGCCAGGTGCTGGAAGTCCATCTGGGCTGGGCCGCCAAGGGCGTGGGCTACCGCAT
CGCCGACATGCTGCGCGACGAGCGCACGGCGCAGGCCAAGAGCGTCCGCGGCTACCTGGAGAAGGTGTACAACACCACGG
GCAGCAGCGCGCATATCGACAGCCTGACCGACGAGGAAGTGCTGGAACTGGCCAACAACCTGAAGAAGGGTGTGCCGTTT
GCCACGCCGGTGTTCGACGGTGCGACCGAAGAAGAAATCGGCAAGATGCTGGAACTGGCCTATCCCGACGACGTCGCCGC
GCGCATGCGCCTGACGGCGTCGCGTTCGCAGGCATGGCTGTATGACGGCCGTACCGGCGAGCAGTTCGAGCGTCCGGTCA
CGATCGGCTACATGCACTACCTGAAACTGCACCACTTGGTGGACGACAAGATGCACGCGCGTTCCACCGGCCCGTACTCG
CTGGTTACCCAGCAGCCGTTGGGCGGCAAGGCGCAGTTCGGCGGTCAGCGTTTCGGGGAAATGGAAGTGTGGGCGCTGGA
AGCCTACGGCGCCTCCTACACCCTGCAGGAAATGCTGACGGTGAAGTCCGACGACATCACCGGCCGCACGAAGGTTTACG
AAAACATCGTCAAGGGCGACCACGTCATCGATGCCGGCATGCCGGAATCGTTCAACGTGCTGGTCAAGGAAATTCGCTCG
CTGGCCCTGGACATGGATTTGGAGCGTAACTGA

>Rif|NC_002516.2.881699|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCTTACTCATACACTGAGAAAAAACGTATCCGCAAGGACTTTAGCAAGTTGCCGGACGTCATGGATGTGCCGTATTT
GCTGGCCATCCAGCTGGATTCCTATCGCGAATTCCTGCAGGCTGGCGCAACCAAGGAGCAGTTCCGCGATGTCGGTCTGC
ACGCGGCCTTCAAGTCCGTTTTCCCGATTATCAGCTATTCCGGCAATGCTGCCCTGGAATACGTCGGCTACCGTCTGGGT
GAGCCGGCATTCGATGTCAAGGAGTGCGTGCTGCGCGGCGTGACCTTCGCCGTACCGCTGCGCGTGAAAGTTCGCCTGAT
CATCTTCGACCGCGAGTCGTCGAACAAGGCGATCAAGGACATCAAGGAACAAGAAGTCTACATGGGGGAAATCCCCCTGA
TGACCGAGAACGGTACCTTCATCATCAACGGTACCGAGCGTGTCATCGTCTCCCAGCTGCACCGTTCCCCGGGCGTGTTC
TTCGACCACGACCGTGGCAAGACCCACAGCTCCGGCAAGCTGCTGTACTCCGCGCGGATCATTCCTTACCGCGGTTCCTG
GCTGGACTTCGAGTTCGATCCGAAGGACTGCGTGTTCGTCCGTATCGACCGTCGCCGCAAGCTGCCGGCCTCGGTACTGC
TGCGCGCGCTCGGCTACAGCACGGAAGAGATCCTCAACGCCTTCTACGCGACCAACGTCTTCCACATCAAGGGCGAGACC
CTGAACCTGGAACTGGTCCCGCAGCGCCTGCGCGGTGAAGTCGCGAGCATCGACATCAAGGATGGCAGCGGCAAGGTGAT
CGTGGAGCAGGGGCGTCGTATCACTGCCCGCCACATCAACCAGCTGGAAAAGGCTGGCGTGAGCCAGCTGGAAGTGCCGT
TCGACTACCTGATCGGCCGTACCATCGCCAAGGCGATCGTGCATCCGGCTACCGGCGAGATCATCGCCGAGTGCAACACC
GAGCTGACCCTCGACCTCCTGGCCAAGGTGGCCAAGGCCCAGGTCGTGCGCATCGAGACCCTGTACACCAACGACATCGA
CTGCGGTCCGTTCATCTCCGACACCCTGAAGATCGACAACACCAGCAACCAGCTGGAAGCCCTGGTCGAGATCTACCGGA
TGATGCGTCCGGGCGAGCCGCCGACCAAGGAAGCTGCCGAGACCCTGTTCGGCAACCTGTTCTTCAGCGCCGAGCGTTAC
GACCTGTCGGCCGTAGGCCGGATGAAGTTCAACCGCCGTATCGGTCGTACCGAGATCGAAGGTCCGGGCGTCCTGAGCAA
GGAAGACATCATCGATGTGCTCAAGACCCTCGTCGACATCCGTAACGGCAAGGGCATCGTCGATGACATCGACCACCTGG
GCAACCGTCGTGTCCGTTGCGTCGGCGAAATGGCCGAGAACCAGTTCCGCGTGGGCCTGGTGCGTGTCGAGCGCGCGGTC
AAGGAACGCCTGTCCATGGCCGAAAGCGAAGGCCTGATGCCGCAAGACCTGATCAACGCCAAGCCGGTGGCTGCCGCGAT
CAAGGAGTTCTTCGGTTCGAGCCAGCTGTCGCAGTTCATGGACCAGAACAACCCGCTTTCCGAGATCACCCACAAGCGCC
GCGTCTCCGCGCTCGGCCCGGGCGGTCTGACCCGTGAGCGTGCGGGCTTCGAGGTTCGTGACGTACACCCGACCCACTAC
GGCCGCGTGTGCCCGATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCCCTGGCGACCTACGCCCGCACCAA
CAAGTACGGCTTCCTCGAGAGCCCGTACCGCGTGGTCAAGGACAGCCTGGTAACCGACGAGATCGTGTTCCTGTCGGCGA
TCGAAGAAGCCGACCACGTCATCGCCCAGGCTTCGGCGACCCTCAACGAGAAGGGTCAACTGGTGGACGAGCTGGTGGCC
GTGCGTCACCTGAACGAATTCACCGTGAAGGCGCCGGAAGACGTGACCCTGATGGACGTGTCGCCGAAGCAGGTCGTTTC
CGTCGCTGCCTCGCTGATTCCGTTCCTCGAGCACGATGACGCCAACCGCGCACTCATGGGCTCGAACATGCAGCGTCAGG
CCGTGCCGACCCTGCGTGCCGACAAGCCGCTGGTGGGTACCGGCATGGAGCGCAACGTGGCGCGCGACTCCGGCGTCTGC
GTCGTGGCTCGCCGTGGCGGTGTGATCGACTCGGTCGATGCCAGCCGTGTCGTGGTTCGCGTGGCGGATGACGAAGTCGA
GACCGGCGAAGCGGGTGTCGACATCTACAACCTGACCAAGTACACTCGTTCCAACCAGAACACCTGCATCAACCAGCGTC
CGCTGGTGAGCAAGGGTGACGTGGTCGCGCGCGGCGACATCCTGGCCGACGGTCCGTCCACCGACATGGGCGAACTGGCC
CTGGGCCAGAACATGCGCGTAGCGTTCATGCCCTGGAACGGCTTCAACTTCGAAGACTCCATCTGCCTGTCCGAGCGCGT
GGTCCAGGAAGATCGTTTCACCACGATCCACATCCAGGAACTGACCTGCGTCGCTCGTGACACCAAGCTCGGCCCAGAGG
AAATCACCGCGGACATCCCGAACGTGGGCGAGGCCGCGCTGAACAAGCTGGACGAAGCCGGTATCGTCTACGTCGGCGCC
GAAGTGCAGGCCGGCGACATCCTGGTCGGCAAGGTCACTCCGAAAGGCGAGACCCAGCTGACTCCGGAAGAGAAGCTGCT
GCGCGCGATCTTCGGTGAGAAGGCGTCCGACGTGAAGGACACCTCCCTGCGTGTGCCGACCGGCACCAAGGGTACCGTCA
TCGACGTTCAGGTCTTCACCCGCGACGGCGTCGAGCGCGATTCCCGCGCGCTGTCCATCGAGAAGATGCAACTCGACCAG
ATCCGCAAGGACCTGAACGAAGAGTTCCGCATCGTCGAAGGCGCGACCTTCGAGCGTCTGCGTGCCGCCCTGGTCGGTGC
CAAGGCTGAAGGTGGCCCGGCGCTGAAGAAGGGCACGGAGATCACCGACGACTACCTCGACGGTCTCGAGCGCGGCCAGT
GGTTCAAGCTGCGCATGGCCGACGACGCCCTGAACGAACAGCTGGAGAAGGCCCAGGCCTACATCAGCGATCGTCGCCAG
CTCCTGGACGACAAGTTCGAGGACAAGAAGCGCAAGCTGCAGCAGGGCGACGACCTGGCTCCGGGCGTGCTGAAGATCGT
CAAGGTCTACCTGGCGATCAAGCGTCGCATCCAGCCGGGCGACAAGATGGCCGGCCGTCACGGTAACAAGGGTGTGGTCT
CGGTGATCATGCCGGTGGAAGACATGCCGCACGATGCCAACGGCACCCCGGTCGACATCGTCCTCAACCCGCTGGGCGTA
CCGTCGCGTATGAACGTCGGTCAGATCCTCGAAACCCACCTGGGCCTCGCGGCCAAGGGGCTGGGCGAGAAGATCAACCG
CATGCTCGAAGAGCAGCGCAAGGTCGCCGAACTGCGTAAGTTCCTGCACGAGATCTACAACGAGATCGGCGGTCGCGAGG
AAAACCTCGACGAGCTGGGCGACAACGAGATCCTCGCGCTGGCCAAGAACCTGCGCGGTGGCGTACCGATGGCGACCCCG
GTGTTCGATGGCGCCAAGGAACGCGAGATCAAGGCCATGCTGAAGCTGGCCGACCTGCCGGAAAGCGGCCAGATGCGTCT
GTTCGACGGCCGTACCGGCAACCAGTTCGAGCGTCCGACCACCGTCGGCTACATGTACATGCTCAAGCTGAACCACCTGG
TGGACGACAAGATGCACGCCCGTTCCACCGGCTCGTACAGCCTGGTTACCCAGCAGCCGCTGGGTGGTAAGGCACAGTTC
GGTGGTCAGCGCTTCGGTGAGATGGAGGTGTGGGCGCTGGAAGCCTATGGCGCGGCGTACACCCTGCAGGAAATGCTGAC
GGTCAAGTCGGACGACGTGAACGGCCGGACCAAGATGTACAAGAACATCGTGGACGGCGATCACCGCATGGAGGCCGGCA
TGCCCGAGTCCTTCAACGTTCTGATCAAAGAGATCCGTTCGCTCGGCATCGACATCGAACTGGAAACCGAATAA

>Rif|NC_008702.1.4609796|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCGTATTCCTACACCGAAAAGAAGCGTATCCGCAAGAGCTTCGCCAAGCGCGCGGCCGTGCTCGATGCGCCTTTCCT
GCTCGCCACCCAGATTGAGTCGTTTGCCTCCTTCCTGCAAGCCGAGACTCCGCCGGAGTCGCGTTACAACCAGGGCCTGC
AGGCAGCGTTCACCTCGATCTTTCCGATTTCGAGCCACAGCGGCAACGCCCGGCTCGAGTTCGTCCAGTACATGCTGGGC
GAGCCGGCCTTTGACGTGAAGGAATGCCAACAGCGCGGTCTGACGTTTGCTTCGCCGCTGCGCGCCCGCGTGCGGCTGGT
GATCATGGATCGCGAGGCGCCGAAGGAGACGATCAAGGAAGTCAAGGAGCAAGAGGTGTACATGGGCGAAATCCCGCTCA
TGACCACCACCGGATCCTTCGTGATCAACGGGACCGAGCGTGTCATCGTGTCCCAGCTGCACCGTTCGCCCGGCGTGTTC
TTCGAGCACGACCGCGGCAAGACGCATTCGTCGGGCAAGCTGCTGTTCTCGGCGCGCATCATCCCCTACCGCGGTTCGTG
GCTCGATTTCGAGTTCGACCCCAAGGACTACCTGTATTTCCGCGTCGACCGTCGGCGCAAGATGCCGGTCACCATCCTGC
TGCGCGCGATCGGCATGACGCCGGAAGAGATCCTCGAAACCTTCCACGACTTCGATGCCTTCCACCTGTCCGCCGAGGGT
GCCCAGTTCGAACTGGTGCCGGATCGCCTGCGTGGTGAGGTTGCGCGCTTCGATATCGTCGACCCCACGGGCAAGGTCAT
CGTTGCCCGCGACAAGCGCATCACCGCCAAGCACATCCGCGAACTCGATCAGGCCGGCATCAAGATGATCGGCGTTCCGG
ATGACTTCGTCCTGGGCCGCATCATCGCCCGTAACGTCGTCGACCCCGAAACCGGCGAACTGCTGGCCCGCGCCAACGAG
GAGATCACCGAGGACCTGCTCGGCAAGCTGCGCGACGCGGGTGTCCGCGATCTGGTGACGCTGTATGTGAACGACCTCGA
TCGCGGCGCCTACATCTCGTCCACGCTGCGTATCGACGAAACCGCCGACCAGTGGGCGGCGCGCGTCGCGATCTACCGCA
TGATGCGTCCGGGCGAGCCGCCCACCGAGGAAGCGGTCGAAGCGCTGTTCCAGGGCCTGTTCTACGCGCCGGAGCGTTAC
GACCTCTCCACCGTTGGCCGCATGAAGTTCAACCGTCGCGCCTATCCCGAGAAGATCGACGACAAGGCGCCCGGCTGGCT
CAAGCGCTTCTACGACAAGGTCGGTCCGCATGGCGAGGAAGGCGAAGGCGTGCTCGCCAACGAGGACATCCTCGCGGTGA
TCGGCGTGCTGGTCGAGCTGCGCAACGGCCGCGGTGAGATCGACGATATCGACCACCTCGGCAACCGTCGTGTGCGTTCG
GTTGGCGAACTCGCCGAGAACCAGTTCCGTGCCGGTCTGGTGCGCGTCGAGCGTGCGGTCAAGGAACGCCTGTCGCAGGC
TGAATCCGACAACCTGATGCCCCATGACCTGATCAACGCCAAGCCGATCTCGGCCGCGATCAAGGAGTTCTTCGGCTCGA
GCCAGCTCTCCCAGTTCATGGACCAGACCAATCCGCTGTCCGAGATCACCCACAAGCGCCGCGTCTCGGCGCTCGGCCCG
GGCGGTCTGACGCGCGAGCGTGCCGGCTTCGAAGTGCGCGACGTGCATCCGACCCACTACGGCCGCGTGTGCCCGATCGA
GACCCCGGAAGGCCCGAACATCGGTCTGATCAACTCGCTCGCGGTGTATGCCCGCACCAACCGCCACGGCTTCCTCGAGA
CGCCGTACCGCAAGGTGACCGACGGCAAAGTCACGGACCAGATCGACTTCCTGTCCGCGATCGAAGAAGGCCAGTACGTG
ATCGCCCAGGCGAACGCGGAAATCGGCGGCGACGGCGCGCTTGAGGGCGACCTGGTTTCGTGCCGCCACAAGGGTGAGTT
CATGCTGGCGACCGCCGATCAGGTCCAGTACATGGACGTGGCGCCGGGCCAGATCGTGTCGGTTGCCGCCTCGCTGATTC
CGTTCCTGGAACACGACGATGCGAACCGCGCGCTGATGGGCGCCAACATGCAGCGTCAGGCGGTGCCCTGCCTGCGTCCC
GAAAAGCCGCTGGTCGGTACCGGTATCGAACGCACGGTCGCGGTCGACTCCGGCACCGCGGTGCAGGCGATGCGGGGCGG
TGTGGTGGACTACGTGGATGCGCAGCGCGTTGTGGTGCGGGTGAACGACAACGAAGCCCTCGCGGGCGAAGTCGGTGTCG
ACATCTACAACATGATCAAGTACACCCGCTCCAACCAGAACACCAACATCAACCAGCGTCCGGTGGTGCGGGTGGGCGAT
CTGATCGCCAAGGGTGACGTGATCGCGGACGGCGCTTCGACCGACCTCGGCGAACTTGCCCTCGGCCAGAACATGCTGGT
CGCGTTCATGCCGTGGAACGGCTACAACTTCGAAGACTCGATCCTGATCTCCGAGCGCGTGGTGGCGGATGATCGTTTCA
CCTCGATCCACGTCGAAGAACTCACCGTGGTCGCACGCGACACCAAGCTCGGGCCCGAGGAAATCACCCGCGACATCGCG
TCGTTGGGCGAAGCCCAGCTGTCGCGCCTGGACGAATCCGGCATCGTCTACATCGGTGCCGAAGTCGAAGCCGGCGACGT
GCTGGTCGGCAAGGTCACGCCGAAGGGCGAGACCCAGCTGACGCCGGAAGAAAAGCTGCTGCGCGCGATCTTCGGCGAGA
AGGCGTCGGACGTGAAGGACACCTCGCTGCGCGTGCCGTCCGGCATGACCGGCACCGTGATCGACGTCCAGGTCTTCACC
CGTGAAGGCATCGAACGCGACAAGCGCGCGCAGTCGATCATCGACGACCAGCTGCGCAGCTTCAAGACGGACCTCGCCGA
CCAGATGCGCATCGTCGAGCGCGACGCGTTCGCCCGTATCCAGCGCATGATCGTTGGCCAGAAGGCCAATGGCGGTCCCA
AGAAGCTGGCCAAGGGCGCGGCGATCACCGCCGAGTACCTGGAAACCCTCGAGTTCTATCACTGGTTCGACATCCGCATG
GCGGACGAAGAGCTGGCGATCCAGCTCGAAGCGGTGCGCGAAGGTCTGGAGAAGACCCGCAAGGACTTCGAGCAGGCCTT
CGAGATCAAGAAGAAGAAGCTCACCCAGGGCGACGAACTGCCCCCGGACGTGCAGAAGATGGTCAAGGTCTATCTGGCGG
TGAAGCGTCGTCTGCAGCCGGGCGACAAGATGGCCGGCCGTCACGGTAACAAGGGTGTGGTGTCCAAGATCGTTCCGGTC
GAAGACATGCCTTACATGGAAGACGGCACCCCGGTCGATATCGTGCTCAACCCGCTGGGCGTGCCGTCGCGGATGAACAT
CGGTCAGATTCTCGAAACCCACCTCGGTTGGGCGGCGAAGGGCCTGGGCCAGAAGATCGATCGCCTGCTGCGCGCCAACG
CGGCGGCGGGCGAAGTGCGCGGCCTGCTCGAGGAAATCTACAACGGCAGCGGCAAGCCGGAAGATTTCAGCGAATTTACC
GACGGCGACGTGATCGAACTGGCTACTAACCTGAAGAAGGGCGTGCCGTTCGCAACCCCGGTGTTCGACGGCGCGAAGGA
AGAGGAGATCGCCAAGATGCTCGAACTGGCCGGACTGCCGGTTGGCGGTCAGGTCACGCTGTTCGACGGTCGCACCGGCG
AGGCCTTCGAGCGCAAGGTGACGGTGGGCTACAAGCACGTGCTTAAGCTGCACCACCTGGTCGATGACAAGATGCACGCC
CGCTCGACCGGCCCGTACTCGCTGGTTACCCAGCAGCCGCTGGGCGGCAAGGCGCAGTTCGGCGGCCAGCGTTTCGGGGA
AATGGAAGTCTGGGCACTGGAAGCCTACGGCGCGGCCTACACGCTGCAGGAAATGCTGACGGTGAAGTCCGACGACGTGA
CCGGCCGGACGAAGGTGTACGAAAACATCGTCAAGGGCGAACACAAGATCGATTCCGGCATGCCGGAGTCCTTCAACGTG
CTGGTGAAGGAAATCCGCTCGCTCGCGATCGACATCGATCTCGACCGCGAGTGA

>Rif|NC_009085.4918494|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGATGCACCGTACTTATTATCGATTCAGGTCGATTCGTACAGAACATTCTTGCAAGATGGCAAATCACCAAAAAACCG
CGAAGATATCGGTCTCCAAGCCGCATTTCGTTCAGTTTTTCCTATCGAAAGTTATTCTGGCAATGCTGCTTTAGAATTTG
TTGAGTATAGCCTTGGTAAACCTGAGTTCGATGTACGCGAATGTATTCTTCGTGGCTCGACTTATGCGGCACCAATGCGC
GTTAAAATTCGTTTGATTATTAAAGATCGCGAAACTAAATCGATTAAAGACGTACGCGAACAAGAAGTCTATATGGGTGA
AATTCCACTCATGACTGAAAATGGTACCTTTGTTATCAACGGTACTGAGCGTGTAATCGTATCTCAATTACACCGTTCGC
CAGGCGTATTCTTTGACCATGATAAAGGTAAGACCCACTCAAGTGGTAAAGTGTTGTATTCAGCACGTATCATTCCTTAC
CGTGGTTCATGGTTAGACTTCGAATTTGATGCAAAAGACTTAGTTTACGTACGTATCGACCGTCGTCGTAAATTACTTGC
TACTGTTGTGTTACGTGCACTAGGTTATAACAATGAACAGATCTTGAATTTGTTCTATGAAAAAGTACCTGTGTATCTTG
ACATGGGTAGCTATCAAATTGACCTCGTACCTGAGCGTTTACGTGGTGAAATGGCTCAATTTGATATTACTGACAATGAA
GGTAAAGTCATTGTTGAGCAAGGTAAACGTATTAATGCTCGTCATGTACGTCAAATGGAAGCTGCAGGTTTAACTAAGCT
TTCAGTTCCTGATGAATACTTATATGAGCGTATCACTGCTGAAGATATTACTTTACGTGATGGTGAAGTAATTGCTGCAA
ATACTCTGTTAAGCCATGAAGTAATGGTGAAGTTGGCAGAAGGCGGTGTTAAGCAATTTAATATCTTGTTCACTAACGAT
ATTGACCGTGGTTCATTCGTAGCTGATACATTACGTGCTGACTTGACGCGTGATCGTGAAGAAGCATTAGTAGAAATCTA
CAAAGTAATGCGTCCAGGCGAGCCACCAACAAAAGAAGCTGCTGAAAACTTATTCAATAACTTGTTCTTCTCTTCTGAAC
GCTATGACTTATCTCCAGTAGGTCGTATGAAGTTCAACCGTCGTTTAGGTCGTCCTTACGAAGTTGGTACTGATCAGAAG
TCACGCGAAGTTGAAGGTATTTTATCGCACGAAGATATTATCGATGTATTACGTACATTGGTTGAAATCCGTAACGGTAA
AGGTGAAGTCGACGATATCGACCACTTAGGTAACCGTCGTGTACGTTCTGTTGGTGAAATGACAGAGAACCAATTCCGTG
TAGGTTTAGTTCGTGTTGAGCGTGCTGTTAAAGAGCGTTTAAGCCAAGCAGAAACAGATAACTTGTCTCCACAAGATTTG
ATTAATGCAAAACCAGTTGCTGCTGCAATCAAAGAATTCTTTGGTTCAAGCCAGTTATCTCAGTTTATGGACCAAAACAA
CCCATTATCTGAGATTACACATAAACGTCGTGTATCTGCGCTTGGTCCTGGTGGTTTAACACGTGAACGTGCAGGCTTCG
AAGTACGTGACGTACACCAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTGATC
AACTCGCTTTCTGTATACGCAAAAGCGAATGACTTCGGTTTCTTGGAAACTCCATACCGCAAAGTTATAGATGGTCGTGT
AACTGATGATGTTGAATATTTATCTGCAATTGAAGAAGTAGGTACTGTTATTGCACAGGCCGACTCTGCAGTAGATAAAG
ATGGCAACTTAACAGAAGAATTCGTTTCTGTTCGTCATCAAGGTGAATTCGTACGTATGCCGCCTGAAAAAGTAACGCAT
ATGGACGTTTCTGCACAGCAGGTAGTATCTGTTGCTGCATCACTTATTCCATTCCTTGAACACGATGACGCAAACCGTGC
GCTCATGGGTTCAAACATGCAACGTCAGGCAGTTCCTACTTTACGTGCGGATAAACCGCTTGTAGGTACAGGTATGGAAG
CGAACGTTGCACGTGACTCTGGTGTGTGTGTAATCGCAAACCGTGGCGGTGTAATTGAATATGTAGATGCTTCTCGTATC
GTTATTCGTGTAAACGAAGATGAAATGGTTGCAGGTGAGGCGGGTGTAGATATCTATAACCTCATCAAATATACACGTTC
AAACCAAAATACTTGTATTAACCAAAATGTTATCGTGAACTTGGGCGACAAAGTTGCTCGTGGTGACATCTTGGCAGACG
GTCCGTCAACAGACATGGGTGAACTTGCGCTTGGTCAAAACATGCGTGTAGCGTTCATGACATGGAATGGTTACAACTAC
GAAGACTCGATCTTGTTATCTGAGCGTGTACTTCAAGAAGACCGTTTAACCTCTATTCACATTCAAGAATTGTCATGTGT
AGCACGTGATACTAAGTTAGGTGCAGAAGAAATTACTGCCGATATTCCTAACGTAGGTGAAGCGGCGCTTTCTAAACTTG
ATGAATCAGGTATCGTTTATATCGGTGCAGAAGTTACTGCTGGTGACATCTTAGTTGGTAAAGTAACGCCTAAAGGTGAA
ACTCAGTTAACTCCTGAAGAAAAACTGCTTCGTGCAATTTTTGGTGAGAAAGCAGCTGACGTTAAAGACTCATCTTTACG
TGTTCCATCTGGTACTAAAGGTACAGTTATTGACGTTCAAGTCTTCACTCGTGATGGCTTAGAGAAAGATGACCGTGCTT
TAGCAATTGAAAAAGCACAGCTTGATTCTTACCGTAAAGACTTGAAAGAAGAATACAAGATCTTCGAAGAAGCGGCTCGT
GAGCGTGTAATTCGTTTGCTTAAAGGCCAAGAGTCTAATGGCGGTGGTTCAACTAAACGTGGTGATAAACTTTCTGAAGA
TTTATTATCTGGTTTAGAGCTTGTTGACTTACTTGAAATTCAACCAGCAGATGAAGCAATCGCTGAGCGTTTAACTCAAA
TTCAAGTGTTCTTGAAAGAGAAGAGCGCAGAAATCGATGAGAAATTCGCTGAGAAGAAACGTAAGCTTGCAACAGGTGAT
GAATTAACAACTGGCGTATTAAAAGTTGTTAAGGTTTACTTAGCTGTTAAACGTCGTATTCAGCCTGGTGATAAGATGGC
TGGTCGTCACGGTAACAAAGGTGTTGTATCTAACATCTTACCTGTTGAAGACATGCCACATGATGCTAACGGTGTGCCAG
TAGATATCGTATTGAACCCGCTGGGTGTACCATCTCGTATGAACGTGGGTCAGATTCTAGAGACTCACTTGGGTATGGCG
GCTAAAGGGCTTGGTGACAAAATCGAAAAAATGTTGAAAGAACAACGTACAGTTTTAGAACTGCGCGAATTCTTAGACAA
GATTTATAACAAAGTCGGTGGTGAGCAAGAAGATCTTGATAGCTTGACTGATGAAGAAATTCTAGCGCTTGCAGGTAACT
TGCGTGCGGGTGTGCCTTTAGCTACTCCTGTATTTGATGGTGCTGAAGAAAGTCAAATTAAAGACTTACTTGAATTGGCT
GACATTTCACGTACGGGTCAAACAGTATTGTTTGACGGACGTACAGGTGAACAGTTTGACCGTCCAGTAACTGTTGGTTA
CATGTACATGCTTAAATTGAACCACTTGGTTGATGACAAGATGCATGCGCGTTCAACTGGTTCTTACTCACTTGTTACAC
AACAACCGCTTGGTGGTAAAGCACAATTCGGTGGTCAGCGTTTCGGTGAGATGGAAGTATGGGCACTTGAAGCATACGGT
GCAGCATATACACTCCAAGAAATGCTTACAGTGAAGTCGGATGACGTTGAAGGCCGTACTCGCATCTATAAGAATATTGT
AGATGGTAACCATTATATGGATCCGGGTATGCCTGAATCGTTCAACGTATTGACCAAAGAGATCCGTTCTTTAGGTATCA
ACATTGACTAA

>Rif|NC_010400.5987325|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCATACTCATATACCGAAAAGAAACGGATCCGTAAGAATTTTGGTAAATTGCCCCAAGTAATGGATGCACCGTACTT
ATTATCGATTCAGGTCGATTCGTACAGAACATTCTTGCAAGATGGCAAATCACCAAAAAACCGCGAAGACATCGGTCTCC
AAGCCGCATTTCGTTCAGTTTTTCCTATCGAAAGTTATTCTGGCAATGCTGCTTTAGAATTTGTTGAGTATAGCCTTGGT
AAACCTGAGTTCGATGTACGCGAATGTATTCTTCGTGGCTCGACTTATGCGGCACCAATGCGCGTTAAAATTCGTTTGAT
TATTAAAGATCGCGAAACTAAATCAATTAAAGACGTACGCGAACAAGAAGTCTATATGGGTGAAATTCCACTCATGACTG
AAAATGGTACCTTTGTTATCAACGGTACTGAGCGTGTAATCGTATCTCAATTGCACCGTTCGCCAGGCGTATTCTTTGAC
CATGATAAAGGTAAGACCCACTCAAGTGGTAAAGTGTTGTATTCAGCACGTATCATTCCTTACCGTGGTTCATGGTTAGA
CTTCGAATTTGATGCAAAAGACTTAGTTTACGTACGTATCGATCGTCGTCGTAAATTACTTGCTACAGTTGTGTTACGTG
CACTAGGTTATAACAATGAACAGATCTTGAATTTGTTCTATGAAAAATTACCTGTGTATCTTGACATGGGTAGCTATCAA
ATTGACCTTGTACCTGAGCGTTTACGTGGTGAAATGGCTCAATTTGATATTACTGACAATGAAGGTAAAGTCATTGTTGA
GCAAGGTAAACGTATTAATGCTCGTCACGTACGTCAAATGGAAGCTGCAGGTTTAACTAAGCTTTCAGTTCCTGATGAAT
ACTTATATGAGCGTATCACTGCTGAAGATATTACTTTACGTGATGGTGAAGTAATTGCTGCAAACACTCTGTTAAGCCAT
GAAGTAATGGTGAAATTGGCAGAAGGCGGTGTTAAGCAATTTAATATCTTGTTCACTAACGATATTGACCGTGGTTCATT
CGTAGCTGATACATTACGTGCTGACTTGACGCGTGATCGTGAAGAAGCATTAGTAGAAATTTACAAAGTAATGCGTCCAG
GCGAGCCACCAACAAAAGAAGCTGCTGAAAACTTATTCAATAACTTGTTCTTCTCTTCTGAACGCTATGACTTATCTCCA
GTAGGTCGTATGAAGTTCAACCGTCGTTTAGGTCGTCCTTACGAAGTTGGTACTGATCAGAAGTCACGCGAAGTTGAAGG
TATTTTATCGCACGAAGATATTATCGATGTATTACGTACATTGGTTGAAATCCGTAACGGTAAAGGTGAAGTCGACGATA
TCGACCACTTAGGTAACCGTCGTGTACGTTCTGTTGGTGAAATGACAGAGAACCAATTCCGTGTAGGTTTAGTTCGTGTT
GAGCGTGCTGTTAAAGAGCGTTTAAGCCAAGCAGAAACAGATAACTTGTCTCCACAAGATTTGATTAATGCAAAACCAGT
TGCTGCTGCAATCAAAGAATTCTTTGGTTCAAGCCAGTTATCTCAGTTTATGGACCAAAACAACCCATTATCTGAGATTA
CACATAAACGTCGTGTATCTGCGCTTGGTCCTGGTGGTTTAACACGTGAACGTGCAGGCTTCGAAGTACGTGACGTACAC
CAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTGATCAACTCGCTTTCTGTATA
CGCAAAAGCGAATGACTTCGGTTTCTTGGAAACTCCATACCGCAAAGTTGTAGATGGTCGTGTAACTGATGATGTTGAAT
ATTTATCTGCAATTGAAGAAGTAGGTACTGTTATTGCACAGGCCGACTCTGCAGTAGATAAAGATGGCAACTTAACAGAA
GAATTCGTTTCTGTTCGTCATCAAGGTGAATTCGTACGTATGCCGCCTGAAAAAGTAACGCATATGGACGTTTCTGCACA
GCAGGTAGTATCTGTTGCTGCATCACTTATTCCATTCCTTGAACACGATGACGCAAACCGTGCGCTCATGGGTTCAAACA
TGCAACGTCAGGCAGTTCCTACTTTACGTGCGGATAAACCGCTTGTAGGTACAGGTATGGAAGCGAACGTTGCACGTGAC
TCTGGTGTGTGTGTAATCGCAAACCGTGGCGGTGTAATTGAATATGTAGATGCTTCTCGTATCGTTATTCGTGTAAACGA
AGATGAAATGGTTGCAGGTGAGGCAGGTGTAGATATCTATAACCTCATCAAATATACGCGTTCAAACCAAAATACTTGTA
TTAACCAAAATGTTATCGTGAACTTGGGCGACAAAGTTGCTCGTGGTGACATCTTGGCAGACGGTCCGTCAACAGACATG
GGTGAACTTGCGCTTGGTCAAAACATGCGTGTAGCGTTCATGACATGGAATGGTTACAACTACGAAGACTCGATCTTGTT
ATCTGAGCGTGTACTTCAAGAAGACCGTTTAACCTCTATTCACATTCAAGAATTGTCATGTGTAGCACGTGATACTAAGT
TAGGTGCAGAAGAAATTACTGCCGATATTCCTAACGTAGGTGAAGCTGCGCTTTCTAAACTTGATGAATCAGGTATCGTT
TATATCGGTGCTGAAGTTACTGCTGGTGACATCTTAGTTGGTAAAGTAACGCCTAAAGGTGAAACTCAGTTAACTCCTGA
AGAAAAACTGCTTCGTGCAATTTTTGGTGAGAAAGCAGCTGACGTTAAAGACTCATCTTTACGTGTTCCATCTGGTACTA
AAGGTACAGTTATTGACGTTCAAGTCTTCACTCGTGATGGCTTAGAGAAAGATGACCGTGCTTTAGCAATTGAAAAAGCA
CAGCTTGATTCTTATCGTAAAGATTTGAAAGAAGAATACAAGATCTTCGAAGAAGCGGCTCGTGAGCGTGTAATTCGTTT
GCTTAAAGGCCAAGAGTCTAATGGCGGTGGTTCAACTAAACGTGGTGATAAACTTTCTGAAGATTTATTATCTGGTTTAG
AGCTTGTTGACTTACTTGAAATTCAACCAGCAGATGAAGCAATCGCTGAGCGTTTAACTCAAATTCAAGTGTTCTTGAAA
GAGAAGAGCGCAGAAATCGATGAGAAATTCGCTGAGAAGAAACGTAAGCTTGCAACAGGTGATGAATTAACAACTGGTGT
ATTAAAAGTTGTTAAAGTTTACTTAGCTGTTAAACGTCGTATTCAGCCTGGTGATAAGATGGCTGGTCGTCACGGTAACA
AAGGTGTTGTATCTAACATCTTACCTGTTGAAGACATGCCACATGATGCTAACGGTGTGCCGGTAGATATCGTATTGAAC
CCGCTGGGTGTACCATCTCGTATGAACGTGGGTCAGATTCTAGAGACTCACTTGGGTATGGCGGCTAAAGGGCTTGGTGA
CAAAATCGAAAAAATGTTGAAAGAACAACGTACAGTTTTAGAACTGCGCGAATTCTTAGACAAGATTTATAACAAAGTCG
GCGGTGAGCAAGAAGATCTTGATAGCTTGACTGATGAAGAAATTCTAGCGCTTGCAGGTAACTTGCGTGCGGGTGTGCCT
TTAGCTACTCCTGTATTTGATGGTGCTGAAGAAAGTCAAATTAAAGACTTACTTGAATTGGCTGACATTTCACGTACGGG
TCAAACAGTATTGTTTGATGGACGTACAGGTGAACAGTTTGACCGTCCAGTAACTGTTGGTTACATGTACATGCTTAAAT
TGAACCACTTGGTTGATGACAAGATGCATGCGCGTTCAACTGGTTCTTACTCACTTGTTACACAACAACCGCTTGGTGGT
AAAGCACAATTCGGTGGTCAGCGTTTCGGTGAGATGGAAGTATGGGCACTTGAAGCATACGGTGCAGCATATACACTCCA
AGAAATGCTCACAGTGAAGTCGGATGACGTTGAAGGCCGTACTCGCATCTATAAGAACATTGTAGATGGTAACCATTATA
TGGATCCGGGTATGCCTGAATCGTTCAACGTATTGACCAAAGAGATCCGTTCTTTAGGTATCAACATTGAACTAAAAAAT
GGTGACTAA

>Rif|CP001918.1|gene250|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGACATTCCATATCT
CCTTTCTATCCAGCTTGACTCGTTCCAGAAGTTTATCGAGCAAGATCCTGAAGGGCAGTACGGTCTGGAAGCAGCCTTCC
GTTCCGTGTTCCCAATTCAGAGCTACAGCGGTAACTCCGAGCTGCAGTACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTTCAGGAATGTCAGATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTAAAACTGCGTCTGGTGATCTACGAGCG
CGAAGCGCCGGAAGGCACTGTTAAAGACATTAAAGAACAAGAAGTCTACATGGGTGAAATTCCACTCATGACAGACAACG
GTACTTTCGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGCCCGGGCGTCTTCTTCGACAGCGAT
AAAGGTAAAACACACTCTTCCGGTAAAGTACTGTATAACGCGCGCATCATTCCTTACCGTGGTTCATGGCTGGACTTCGA
GTTCGATCCAAAAGACAACCTGTTTGTCCGTATCGACCGTCGTCGTAAACTGCCTGCAACCATCATTCTGCGCGCACTGA
ACTATACCACTGAACAGATCCTGGACCTGTTCTTTGAAAAAGTGATCTTTGAAATCCGCGACAACAAGCTGCAGATGGAG
CTGGTGCCGGAACGTCTGCGTGGTGAGACCGCGTCGTTCGACATCGAAGCCGACGGCAAAGTGTATGTGGAAAAAGGTCG
CCGTATTACCGCGCGCCACATCCGTCAGCTGGAAAAAGATGATATCAAACACATCGAAGTTCCGGTTGAATACATTGCAG
GAAAAGTAGCCGCGAAAGATTACGTTGATGAATCAACTGGCGAGCTGATCTGCCCGGCTAACATGGAGCTGAGCCTGGAT
CTGCTGGCTAAGCTGAGTCAGGCTGGCCACAAACGTATCGAAACGCTGTTCACTAACGATCTGGACCACGGTCCGTACAT
CTCTGAGACTGTACGCGTCGACCCAACCAACGATCGTCTGAGCGCGTTGGTAGAAATCTACCGCATGATGCGTCCTGGTG
AGCCACCAACTCGCGAAGCAGCTGAAAGCCTGTTCGAGAACCTGTTCTTCTCTGAAGACCGCTACGATCTGTCTGCAGTT
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGATGAGATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATCGA
AGTGATGAAGAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTGGACGACATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTAGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAAGCCGATTTCTGCAGCAGTGAAAGAGTTCTTCGG
TTCCAGCCAGCTGTCTCAGTTCATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCTGCACTCG
GCCCAGGCGGTCTGACCCGTGAACGCGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCA
ATCGAAACGCCTGAAGGTCCAAACATCGGTCTGATCAACTCCCTGTCCGTGTACGCACAGACAAACGAATACGGTTTCCT
TGAGACCCCGTACCGTAAAGTGACTGACGGTGTTGTTACCGACGAAATTCATTACCTGTCTGCTATTGAAGAAGGCAACT
ACGTTATCGCTCAGGCGAACTCCAACCTGGATGACGAAGGCCACTTTGTAGAAGATCTGGTTACCTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCAACTCTGC
GTGCTGATAAGCCGCTGGTTGGTACCGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTTACTGCAGTGGCTAAGCGT
GGCGGTACCGTTCAGTACGTTGACGCATCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGCGAAGCGGG
TATCGACATCTACAACCTGACTAAATACACCCGTTCTAACCAAAACACCTGTATCAACCAGATGCCTTGCGTATCTCTGG
GTGAGCCAGTTGAGCGCGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTTGGTGAACTGGCGCTCGGTCAGAACATG
CGCGTAGCGTTCATGCCTTGGAACGGTTACAACTTCGAAGACTCCATCCTCGTCTCCGAACGTGTGGTACAGGAAGATCG
TTTCACCACCATCCACATTCAGGAACTGGCCTGTGTGTCCCGTGACACCAAGCTGGGGCCAGAAGAGATCACCGCTGACA
TCCCTAACGTGGGTGAAGCTGCGCTCTCTAAACTGGATGAATCCGGTATCGTTTACATCGGTGCGGAAGTGACCGGCGGC
GACATTCTGGTTGGTAAGGTAACGCCGAAAGGTGAAACCCAGCTGACGCCAGAAGAGAAACTGCTGCGTGCAATCTTCGG
TGAGAAAGCGTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTTTCCGGTACGGTTATCGACGTTCAGGTCT
TCACCCGTGACGGCGTTGAGAAAGATAAACGTGCGCTGGAAATCGAAGAGATGCAGCTCAAACAGGCTAAGAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCTACGCGGTGCTGGTTGCCGGTGGCGTTGAAGCTGA
GAAGCTCGACAAACTGCCACGCGATCGCTGGCTGGAACTGGGCCTGACCGACGAAGAGAAACAAAATCAGCTGGAACAGC
TGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAAAAACTCGAAGCGAAACGCCGCAAAATCACTCAGGGCGAC
GATCTGGCACCAGGCGTGCTGAAGATTGTTAAGGTGTATCTGGCTGTTAAACGTCAGATCCAGCCTGGTGATAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTTATCTCTAAGATCAACCCGATCGAAGATATGCCGCACGATGCTAACGGTACGCCGG
TAGATATCGTACTGAACCCACTGGGCGTACCGTCTCGTATGAACATCGGTCAGATTCTGGAAACCCACCTGGGTATGGCT
GCGAAAGGTATCGGCGACAAGATTAACGCCATGCTGAAACAGCAGCAGGAAGTCGCGAAACTGCGCGAATTCATCCAGCG
TGCCTACGATCTGGGCACCGATGTGCGTCAGAAAGTCGACCTGAACACCTTCAGCGATGAAGAAGTGCTGCGTCTGGCAG
AGAACCTGCGCAAAGGTATGCCAATTGCAACGCCGGTATTCGACGGTGCAAAAGAAGCTGAAATTAAAGAGCTGCTGCAA
CTGGGTGGTCTGCCAACGTCTGGTCAGATTACGCTGTTTGACGGCCGTACCGGTGAACAGTTCGAGCGTCCGGTAACCGT
AGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAAATGCACGCTCGTTCTACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGCTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCA
TACGGCGCAGCATACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACCAAGATGTATAAGAA
CATCGTGGACGGCAACCATCAGATGGAACCGGGCATGCCAGAGTCCTTCAACGTACTGTTGAAAGAGATTCGTTCGCTGG
GTATCAACATCGAACTGGAAGACGAGTAA

>Rif|CR628337.1|gene378|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCAGTTGCAGAAGCTAAACCTCAATATTCGCATGCTGAGAAAAAACGATTTCGCAAAAGCTTTGGTAAGCAGACAGA
TATAATGCCAATACCGAATCTGCTTGAAATTCAACTTAAATCCTACAGGGATTTTCTTCAAACTGATACTAAATTAAGCG
AACAACTGAATACGGGATTGCATGCTGCATTTTCTTCTGTATTTCCTATCGAAAGCTTTTCTGGTAATGCAAGACTTGAA
TACGTCGGATACAAGCTTGGAGAGCCTGCATTTGATGTTCGCGAATGCAAACTACGAGGGCTAACTTACTCAGCTCCTCT
AAGAGTCAAGATCAGACTCGTTGTGCTTGATAAAGATGCAAGCGATGATCCTAAGCCTATAAAGGATATTAGAGAGCAAG
ATGTTTTTATGGGGGAAATTCCCCTAATGACTGACGTTGGTACGTTTGTGGTCAATGGAACGGAACGTGTTGTTGTTTCA
CAATTACATCGTTCTCCTGGAGTTATATTTGAACATGACAAGGGAAAAACTCACTCTTCAGGTAAATTGCTCTATTCCGC
ACGAATAATACCTTATCGTGGTTCATGGTTAGACTTTGAATTCGATCCTAAAGATTGCGTTTATGTACGTATTGACAGAC
GTCGTAAACTGCCAGTGACCATTTTGCTCAGAGCATTGGGCTACGAAGCAGAAGATATATTAAACGAATTTTTTGAAACA
ACTTGTTGTCATTTAAAAAATGGCGAATACCACATCGATTTAATTCCACAGCGTTTGCGTGGTGAAATCGCTTCATTCGA
TATTCATGTTCCTGAAACTGGAGAGCTTATCGTAGAGCAAGGTCGTCGAATTACCGCAAGACATATAAAGCAAATGGAAA
AAAGCCAAATGCAGGATCTAGTGGTACCAAGAGACTATTTAATTGGAAAAACATTAGCAAAAAATATTATTGATACCTCA
ACCGGTGAATTTCTGGCTCAAGCGAATGATGAGATAACGGAAGAGCTTTTAGATGCTATGGCTAGCCATGGTATTTTACA
AATTGATATGATCTATACTAACGATTTGGATCATGGTTCTTACATATCGGATACATTAAAGATTGATCCCACAGGATCAC
AACTAGAAGCACTCGTTGAAATTTATCGCATGATGCGCCCTGGAGAGCCTCCTACAAAGGAAGCTGCTGAGGCACTATTT
AAAAATCTATTCTTTGTTGAAGAAAGATATGATCTATCTGCTGTTGGCAGAATGAAATTTAATCGTCGGGTAGGAATTAA
GAGTGACGAAGGCCCAGGCACTTTAACGAAGGAAGACATTTTATCTGTCATTAAAACACTGATAGATATTCGAAATGGAA
TAGGGATGGTTGATGATATCGATCATCTAGGAAATCGTAGGGTAAGAAGTGTTGGTGAAATGACCGAAAATCAGTTTAGA
GTAGGTCTTGTTCGTGTTGAACGTGCTGTTAAAGAGCGCTTAAGTTTGGTTGAATCTGAAAATCTGATGCCACAGGACTT
AATTAACGCAAAACCGGTGTCCGCCGCAATTAAAGAGTTTTTTGGATCCAGTCAGTTATCACAGTTTATGGATCAAGTGA
ATCCATTATCTGGTGTTACGCATAAAAGACGTGTATCGGCTCTTGGGCCAGGTGGTTTAACACGTGAGCGTGCTGGATTT
GAAGTCCGTGACGTGCATACAACACACTATGGTCGTGTGTGCCCAATTGAAACGCCTGAAGGACCAAATATTGGTCTAAT
CAATTCACTGTCAGTTTATGCAAGAACTAACGAATATGGATTTATTGAAACTCCTTGTCGAAAGGTTGTTAATGGGCGTG
TGACAGATGAAGTTGAATACCTATCGGCTATTGAGGAAGTTGATCAATACATTGCACAATCTAATGTTGAATTAGACGCA
CAAGGAAATATTCTTGCTGACTTAGTTCCTTGCAGACATCAAAATGAATTTTCACTGACTACTCCGGATAAAATCAACTA
CATGGATGTCTCGCCCAAGCAAATTGTGTCAGTTGCAGCTTCATTGATTCCGTTTTTAGAGCACGATGATGCAAACAGAG
CATTAATGGGTTCAAACATGCAACGACAGGCTGTGCCAACCTTGCGTTCAGAAAAGCCCTTGGTTGGGACCGGTATGGAA
AGAATCGTTGCATCTGATTCAGGAGTTTCAGTTGTTGCGAAGAGAGGTGGAGTTATTGATCTGGTTGATGCTTCTCGTAT
TGTTGTTCGAGTGAATGACGACGAAACAACAGCAGGGGAAACAGGGGTAGATATTTATAACTTAACCAAGTATTTCCGTT
CTAACCAGGATACTTGTATCAATCAAAGACCCATAGTATCAACAGGTGATCGAATTCAACGAGGTGATGTCCTGGCTGAT
GGTCCATGTACAGATATGGGTGAATTGGCTCTTGGACAGAATCTACTGGTAGCGTTTATGCCTTGGAATGGTTATAACTT
TGAGGATTCCATTCTTATATCTGAACGAATCGTTCATGACGACAGATTCACTACTATCCACATCGAAGAGCTAACATGTA
TAGCTCGAGATACCAAATTAGGTACGGAAGAAATTACAGCAGATATTCCCAATGTAGGCGAGTCTGCACTCTCTAATTTA
GATGAATCTGGAGTTGTTTACATAGGTGCAGAAGTTAAAGCAGGTGATATTCTTGTGGGGAAAGTAACTCCTAAAGGAGA
AACCCAACTAACTCCAGAAGAAAAACTGTTAAGAGCCATCTTTGGTGAAAAAGCTTCAGATGTTAAAGATTCATCTTTGA
GAGTTCCATCAGGTATGAATGGAACAGTGATCGATGTACAAGTCTTTACCCGTGATGGACTTGAAAAGGATGCTCGTGCT
AAAAGCATTGAAGAAGAGCATCTGGCTCGAGTTCGCAAGGATTTAATAGACGAACGGCGTATTCGTGAAGAAGACATCTA
TCATAGAGTTTCTCATTTGCTGTTGGATAAGGTTGCAACAGGCGGTCCTGGAAGCCTAAAGCCTGGATCTAAAATCACCC
AGGATTACCTGGATAAAGTTGAAAGAGAAAAGTGGTTTGATATTCGTATAGAAGATGACGCAATTAGTCAGCAACTTGAA
CAACTATCCAAGCAACTGGAACTTTTAACAAAAGAAATGGAAAAGCGCTTTAACGACAGTAGAAAGAAAATTATCCAGGG
AGACGATTTAGCTCCTGGTGTATTAAAAATTGTTAAAGTGTATTTGGCTGTTAAAAGAAGAATTCAGCCTGGAGACAAAA
TGGCAGGTCGTCATGGAAACAAGGGTGTGATCTCCATTGTTGTTCCAGTTGAAGATATGCCGCATATGGAAGATGGAACG
GCTGTAGATATCGTTCTTAATCCATTGGGCGTACCATCGCGAATGAATATCGGCCAGGTTCTTGAAACGCATCTGGGACT
AGCTGCCAAAGGATTGGGAAGAAAGATTGCACAGATGCTTGATGAAAAGCAAACACCTGAAGCAATAAAAGCATACCTTG
AGAAAATTTATAATCATGACGGAGTGCAGCGTGTTAATTTGAAATGCCTCAATGATGATGAATTGATGACACTGGCGGAT
AACCTGAGAGCTGGTGTGCCGATGGCAACTCCTGTCTTTGATGGTGCTACTGAGCAAGAAATCAAAAGTATGCTGCAGTT
AGCAGATTTGCCAGCAGATGGTAAAACCGTGTTGATAGATGGTCGAACAGGTAATAAATTTGATAATCCGGTTACTGTAG
GCTACATGTATATGTTGAAGTTAAACCATTTGGTTGATGATAAGATGCATGCTCGTTCAACTGGATCATACAGTTTGGTC
ACTCAACAACCACTTGGCGGTAAAGCACAGTTTGGTGGTCAGCGTTTTGGTGAGATGGAAGTATGGGCATTAGAAGCATA
TGGTGCAGCATACACTTTACAAGAAATGTTAACCGTAAAATCAGATGACGTCGGAGGTCGAACAAAGATCTATAAAAATA
TAGTCGATGGAGATCATCGTATGGACCCAGGAATGCCTGAATCCTTCAATGTATTATTGAAGGAAATTAGAGCACTGGGA
ATTGATATCGAGTTGGAGCATGACTAA

>Rif|AM180355.1|gene120|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGCCACATCCTGTCACGATAGGTAAAAGAACTAGAATGAGCTTTTCTAAAATTAAGGAAATAGCTGATGTGCCAAATCT
TATAGAAATTCAAGTAGATTCCTATGAGTGGTTTTTAAAAGAAGGTTTAAAAGAAGTGTTTGATGATATTTCACCAATAG
AAGATTATACTGGTAATCTTATATTGGAATTTGTCGACTATTCTCTAGATGATAAACCAAAGTACGATATAGAAGAGTGT
AAAGAGAGAGATGCTACATATTGTGCACCTCTAAAGGTTAAGGTAAGACTTATAAATAAAGAAACAGGTGAGATAAAAGA
ACAAGAAGTGTTTATGGGTGACTTCCCTTTAATGACAGAAAGAGGAACTTTCGTTATAAATGGAGCAGAAAGAGTTATAG
TAAGTCAATTAGTTAGATCTCCTGGTGTTTACTATGCGGAAGAAAGAGATAAAACAGGTAAGAGATTGATTTCATCTACT
GTAATTCCTAATAGAGGAGCATGGTTAGAATATGAAACAGATTCTAATGATGTAATATCTGTAAGAGTTGATAGAACAAG
AAAACAACCAGTTACAGTTTTACTTAGAGCTTTAGGAATAGGAACAGATGCAGAGATAATTGACCTTTTAGGAGAAGATG
AGAGATTATCTGCTACATTAGAAAAAGATAATACTAAGACAGTAGAAGAAGGTCTTGTAGAGATATACAAAAAATTAAGA
CCAGGTGAACCTCCTACTGTAGAAAGTGCATCATCTTTATTAAATGCTTTATTCTTTGACCCAAAAAGATATGACCTAGC
AAAAGTTGGTAGATATAAATTCAATAAGAAACTTGCTTTATGTTATAGAATAATGAATAAAATTTCAGCAGAAGACATAA
TAAATCCAGAAACTGGAGAAGTATTTGTAAAAGCTGGAGAAAAAATAAGCTATGATTTGGCTAAAGCCATACAAAATGCA
GGTATAAATGTAGTAAATCTACTAATGGATGATGATAAAAAAGTTAGAGTTATAGGAAATAATTTTGTGGATATTAAGTC
TCACATTGATTTTGACATAGATGATTTAAACATAAAAGAAAAAGTACATTATCCAACTTTAAAAGAAATTTTAGATGGAT
ATAGTGATGAAGAAGAAATAAAAGAGGCTATAAAATCAAGAATTAAAGAACTTATACCAAAACATATATTATTAGATGAT
ATAATAGCTTCAATAAGTTATGAGTTCAATATATTCTATAATATAGGAAATATTGATGATATAGATCACCTAGGAAACAG
AAGAATAAGATCTGTAGGTGAATTGTTACAAAATCAAGTTAGAATTGGTCTTTCAAGAATGGAAAGAGTTATAAAAGAAA
GAATGACGGTTCAAGATATGGAAGCTATAACGCCTCAAGCGTTAGTTAACATAAGACCAGTTTCAGCTGCAATAAAAGAA
TTTTTTGGTAGTTCTCAGTTATCTCAGTTCATGGATCAAACAAATCCTCTATCTGAGTTAACGCATAAGAGAAGATTATC
AGCCCTTGGGCCTGGAGGTCTTTCAAGAGAAAGAGCTGGATTCGAAGTGCGTGACGTTCACCATTCACACTATGGTAGAA
TGTGTCCAATAGAGACTCCAGAGGGACCAAATATCGGTCTTATAAACTCTCTAGGAACTTATGCAAAAATAAATGAATTT
GGATTTATAGAATCACCATATAGAAAATTTGATAAAGAAACATCAACAGTTACTGATGAAATACATTATTTAACTGCTGA
CGAAGAAGATTTATTCGTAAGAGCTCAGGCAAATGAGCCATTAACAGAAGATGGTAAATTCGTAAACCATAGAGTTGTTT
GTAGAACTGTAAATGGTGCTGTTGAAATGGTTCCTGAAAGTAGAGTAGATTACATGGATATATCTCCTAAGCAGGTTGTA
TCTGTTGCCACTGCTATGATACCTTTCTTAGAAAATGATGATGCCAACCGTGCCCTTATGGGAGCGAACATGCAGCGTCA
GGCAGTGCCTCTAGTTAGAAGAGAAGCACCAATTATAGGAACTGGTATAGAATACAGAGCAGCAAAAGACTCTGGAGCAG
TTGTTGTTGCTAGAAATTCTGGTATAGCAGAAAGAGTAACAGCAGATGAAATAATTATAAAAAGAGAAGATGGAAACAGA
GATAGATATAATCTACTTAAGTTTAAACGTTCAAACTCAGGTACTTGTATAAATCAAACACCTATAATAAATAAGGGTGA
CCAGATAATAAAAGGTGATGTTATAGCAGATGGTCCAGCAACTGATTTAGGAGAAGTTGCACTTGGAAGAAACTGTCTTA
TAGCATTCATGACTTGGGAAGGTTATAACTACGAGGATGCTATATTAATAAATGAAAGATTAGTTAAAGAAGATAGATTA
TCAACAATTCATATAGAAGAATATGAATGTGAAGCTAGAGATACAAAACTAGGGCCAGAGGAAATAACTAGAGATATACC
TAATGTTGGAGATAGTGCAATTAAGAACTTAGATGACAGAGGTATAATAAGAATAGGTGCAGAAGTAGACTCAGGTGATA
TATTAGTTGGTAAAGTAACTCCAAAAGGAGAAACTGAACTTACTGCTGAGGAAAGATTACTTCGTGCAATATTTGGAGAA
AAGGCTAGAGAAGTTAGAGATACTTCACTTAAAGTGCCTCATGGTGAATCTGGTATAATAGTTGATGTAAAAGTATTTAC
TAGAGAAAATGGAGATGATTTATCTCCAGGAGTAAATGAATTAGTAAGATGCTATATAGCTAAAAAGAGAAAAATAAAAG
TTGGAGATAAAATGGCTGGTCGTCATGGTAATAAAGGGGTTATCTCAAGAGTATTACCTGAAGAAGATATGCCATTCATG
GAAAATGGAACACCACTAGACATAATACTTAACCCACAAGGTATACCATCACGTATGAACATTGGTCAGGTTTTAGAAGT
TCATTTAGGACTTGCTGCTAAGACATTAGGATGGTATGTAGCAACATCAGTATTCGATGGTGCTAATGAGTATGACATAA
TGGATGCTCTTGAAGAAGCTGGGTATCCTAGAGATGGTAAATTAACTTTATATGATGGTAGAACAGGTGAGTCTTTTGAC
AACAGAATAACTGTTGGATATATGTACTACTTGAAACTACATCACTTAGTAGATGAAAAACTACATGCAAGAAGTACTGG
ACCATACTCATTAGTTACTCAACAGCCACTAGGTGGTAAAGCACAATTTGGTGGACAAAGATTTGGAGAGATGGAGGTTT
GGGCTCTGGAAGCATATGGAGCTGCTCACATACTTCAAGAAATACTTACTGTTAAGTCTGATGACGTTGTAGGTCGTGTT
AGAACATATGAAGCTATAGTTAAAGGTGAAAATATACCTGAACCAGGAATCCCAGAATCATTTAAGGTTCTTATAAAAGA
ACTTCAAAGTTTATGCTTAGATGTAAAAGTATTGACAGATGAAGACCAAGAAATAGAAGTAAGAGAATCTGTGGATGAAG
ATGATACAATAGGTGAATTTGAGCTAGATGTTGTAAATCATATGGGAGAAGTTGAAGAAAGTAATATAATAGAAGAAATT
GAAGATGATTTTGCAGAAAATGCAGAAGATGAGGATATAGAGAATTTAGAAGAATTCACTGAAGATGATTTATTTGAAGA
AGAAATAGATTTTGATAGTGATGACTTTGATATGTAA

>Rif|NC_010410.6003841|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCATACTCATATACCGAAAAGAAACGGATCCGTAAGAATTTTGGTAAATTGCCCCAAGTAATGGATGCACCGTACTT
ATTATCGATTCAGGTCGATTCGTACAGAACATTCTTGCAAGATGGCAAATCACCAAAAAACCGCGAAGATATCGGTCTCC
AAGCCGCATTTCGTTCAGTTTTTCCTATCGAAAGTTATTCTGGCAATGCTGCTTTAGAATTTGTTGAGTATAGCCTTGGT
AAACCTGAGTTCGATGTACGCGAATGTATTCTTCGTGGCTCGACTTATGCGGCACCAATGCGCGTTAAAATTCGTTTGAT
TATTAAAGATCGCGAAACTAAATCAATTAAAGACGTACGCGAACAAGAAGTCTATATGGGTGAAATTCCGCTCATGACTG
AAAATGGTACCTTTGTTATCAACGGTACTGAGCGTGTAATCGTATCTCAATTACACCGTTCGCCAGGCGTATTCTTTGAC
CATGATAAAGGTAAGACCCACTCAAGTGGTAAAGTGTTGTATTCAGCACGTATCATTCCTTACCGTGGTTCATGGTTAGA
CTTCGAATTTGATGCAAAAGACTTAGTTTACGTACGTATCGACCGTCGTCGTAAATTACTTGCTACAGTTGTGTTACGTG
CACTAGGTTATAACAATGAACAGATCTTGAATTTGTTCTATGAAAAAGTACCTGTGTATCTTGACATGGGTAGCTATCAA
ATTGACCTTGTACCTGAGCGTTTACGTGGTGAAATGGCTCAATTTGATATTACTGACAATGAAGGTAAAGTCATTGTTGA
GCAAGGTAAACGTATTAATGCTCGTCATGTACGTCAAATGGAAGCTGCAGGTTTAACTAAGCTTTCAGTTCCTGATGAAT
ACTTATATGAGCGTATCACTGCTGAAGATATTACTTTACGTGATGGTGAAGTAATTGCTGCAAATACTCTGTTAAGCCAT
GAAGTAATGGTGAAGTTGGCAGAAGGCGGTGTTAAGCAATTTAATATCTTGTTCACTAACGATATTGACCGTGGTTCATT
CGTAGCTGATACATTACGTGCTGACTTGACGCGTGATCGTGAAGAAGCATTAGTAGAAATCTACAAAGTAATGCGTCCAG
GCGAGCCACCAACAAAAGAAGCTGCTGAAAACTTATTCAATAACTTGTTCTTCTCTTCTGAACGCTATGACTTATCTCCA
GTAGGTCGTATGAAGTTCAACCGTCGTTTAGGTCGTCCTTACGAAGTTGGTACTGATCAGAAGTCACGCGAAGTTGAAGG
TATTTTATCGCACGAAGATATTATCGATGTATTACGTACATTGGTTGAAATCCGTAACGGTAAAGGTGAAGTCGACGATA
TCGACCACTTAGGTAACCGTCGTGTACGTTCTGTTGGTGAAATGACAGAGAACCAATTCCGTGTAGGTTTAGTTCGTGTT
GAGCGTGCTGTTAAAGAGCGTTTAAGCCAAGCAGAAACAGATAACTTGTCTCCACAAGATTTGATTAATGCAAAACCAGT
TGCTGCTGCAATCAAAGAATTCTTTGGTTCAAGCCAGTTATCTCAGTTTATGGACCAAAACAACCCACTATCTGAGATTA
CACATAAACGTCGTGTATCTGCGCTTGGTCCTGGTGGTTTAACACGTGAACGTGCGGGCTTCGAAGTACGTGACGTACAC
CAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTGATCAACTCGCTTTCTGTATA
CGCAAAAGCGAATGACTTCGGTTTCTTGGAAACTCCATACCGCAAAGTTGTAGATGGTCGTGTAACTGATGATGTTGAAT
ATTTATCTGCAATTGAAGAAGTAGGCACTGTTATTGCACAGGCCGACTCTGCAGTAGATAAAGATGGCAACTTAACAGAA
GAATTCGTTTCTGTTCGTCATCAAGGTGAATTCGTACGTATGCCGCCTGAAAAAGTAACGCATATGGACGTTTCTGCACA
GCAGGTAGTATCTGTTGCTGCATCACTTATTCCATTCCTTGAACACGATGACGCAAACCGTGCGCTCATGGGTTCAAACA
TGCAACGTCAGGCAGTTCCTACTTTACGTGCGGATAAACCGCTTGTAGGTACAGGTATGGAAGCGAACGTTGCACGTGAC
TCTGGTGTGTGTGTAATCGCAAACCGTGGCGGTGTAATTGAATATGTAGATGCTTCTCGTATCGTTATTCGTGTAAACGA
AGATGAAATGGTTGCAGGTGAGGCAGGTGTAGATATCTATAACCTCATCAAATATACGCGTTCAAACCAAAATACTTGTA
TTAACCAAAATGTTATCGTGAACTTGGGCGACAAAGTTGCTCGTGGTGACATCTTGGCAGACGGTCCGTCAACAGACATG
GGTGAACTTGCGCTTGGTCAAAACATGCGTGTAGCGTTCATGACATGGAATGGTTACAACTACGAAGACTCGATCTTGTT
ATCTGAGCGTGTACTTCAAGAAGACCGTTTAACCTCTATTCACATTCAAGAATTGTCATGTGTAGCACGTGATACTAAGT
TAGGTGCAGAAGAAATTACTGCCGATATTCCTAACGTAGGTGAAGCTGCGCTTTCTAAACTTGATGAATCAGGTATCGTT
TATATCGGTGCTGAAGTTACTGCTGGTGACATCTTAGTTGGTAAAGTAACGCCTAAAGGTGAAACTCAGTTAACTCCTGA
AGAAAAACTGCTTCGTGCAATTTTTGGTGAGAAAGCAGCTGACGTTAAAGACTCATCTTTACGTGTTCCATCTGGTACTA
AAGGTACAGTTATTGACGTTCAAGTCTTCACTCGTGATGGCTTAGAGAAAGATGACCGTGCTTTAGCAATTGAAAAAGCA
CAGCTTGATTCTTATCGTAAAGACTTGAAAGAAGAATACAAGATCTTCGAAGAAGCGGCTCGTGAGCGTGTAATTCGTTT
GCTTAAAGGCCAAGAGTCTAATGGCGGTGGTTCAACTAAACGTGGTGATAAACTTTCTGAAGATTTATTATCTGGTTTAG
AGCTTGTTGACTTACTTGAAATTCAACCAGCAGATGAAGCAATCGCTGAGCGTTTAACTCAAATTCAAGTGTTCTTGAAA
GAGAAGAGCGCAGAAATCGATGAGAAATTCGCTGAGAAGAAACGTAAGCTTGCAACAGGTGATGAATTAACAACTGGTGT
ATTGAAAGTTGTTAAAGTTTACTTAGCTGTTAAACGTCGTATTCAGCCTGGTGATAAGATGGCTGGTCGTCACGGTAACA
AAGGTGTTGTATCTAACATCTTACCTGTTGAAGACATGCCACATGATGCTAACGGTGTGCCGGTAGATATCGTATTGAAC
CCGCTGGGTGTACCATCTCGTATGAACGTGGGTCAGATTCTAGAGACTCACTTGGGTATGGCGGCTAAAGGGCTTGGTGA
CAAAATCGAAAAAATGTTGAAAGAACAACGTACAGTTTTAGAACTGCGCGAATTCTTAGACAAGATTTATAACAAAGTCG
GCGGTGAGCAAGAAGATCTTGATAGCTTGACTGATGAAGAAATTCTAGCGCTTGCAGGTAACTTGCGTGCGGGTGTGCCT
TTAGCTACTCCTGTATTTGATGGTGCTGAAGAAAGTCAAATTAAAGACTTACTTGAATTGGCTGACATTTCACGTACGGG
TCAAACAGTATTGTTTGACGGACGTACAGGTGAACAGTTTGACCGTCCAGTAACTGTTGGTTACATGTACATGCTTAAAT
TGAACCACTTGGTTGATGACAAGATGCATGCGCGTTCAACTGGTTCTTACTCACTTGTTACACAACAACCGCTTGGTGGT
AAAGCACAATTCGGTGGTCAGCGTTTCGGTGAGATGGAAGTGTGGGCACTTGAAGCATACGGTGCAGCATATACACTCCA
AGAAATGCTTACAGTGAAGTCGGATGACGTTGAAGGCCGTACTCGCATCTATAAGAATATTGTAGATGGTAACCATTATA
TGGATCCGGGTATGCCTGAATCGTTCAACGTATTGACCAAAGAGATCCGTTCTTTAGGTATCAACATTGAACTAAAAAAT
GGTGACTAA

>Rif|NC_009725.1.5459527|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
GTGAATCAGTTGACAGGTCAACTAGTTCAGTATGGACGACACCGCCAGCGCAGAAGCTATGCTCGCATTAGCGAAGTGTT
AGAATTACCAAATCTCATTGAAATTCAAACCTCTTCTTATCAGTGGTTTCTTGATGAGGGTCTTAGAGAGATGTTTCAAG
ACATATCACCAATTGAGGATTTCACTGGTAACCTCTCTCTAGAGTTCATTGACTACAGTTTAGGAGATCCTAAGTATCCC
GTTGAAGAGTCAAAAGAACGTGATGTGACTTACTCAGCTCCGCTGAGAGTGAAGGTTCGTTTAATTAACAAAGAAACTGG
AGAGGTAAAAGACCAGGATGTCTTCATGGGTGATTTCCCTATTATGACAGATACCGGTACTTTTATCATCAACGGTGCAG
AACGTGTTATCGTATCTCAGCTTGTTCGGTCTCCAAGTGTATATTTCAGTGGTAAAGTAGACAAGAACGGTAAAAAAGGT
TTTACCGCGACTGTCATTCCAAACCGTGGCGCATGGTTAGAATACGAAACTGATGCGAAAGATGTTGTGTATGTCCGCAT
TGATCGCACACGTAAGTTGCCGGTTACGGTTCTTTTGCGTGCTCTCGGCTTCGGTTCCGACCAAGAGATTCTCGATCTCA
TTGGTGAGAACGAATATCTCCGCAATACACTGGATAAGGACAACACTGAAAACAGTGACAAAGCGCTTCTTGAAATCTAT
GAGCGCCTTCGTCCCGGAGAGCCGCCTACAGTAGAAAACGCAAAAAGCTTGCTGGATTCCCGTTTCTTCGATCCGAAGCG
ATACGACCTTGCGAATGTAGGACGCTATAAAATTAATAAAAAGCTTCATATCAAGAACCGCCTGTTTAACCAACGCCTTG
CAGAAACACTGGTGGATCCGGAAACCGGTGAAATTCTCGCTGAAAAAGGGCAGATTCTTGACAGAAGAACACTTGATAAA
GTACTGCCATACTTAGAAAATGGAATCGGCTTCAGAAAACTTTATCCTAACGGCGGCGTTGTCGAGGATGAAGTGATGCT
TCAATCCATTAAAATCTATGCTCCTACCGATGCAGAAGGAGAGCAGACGATCAATGTGATCGGCAATGCTTACATCGAAG
AGGCGATTAAAAACATTACGCCTGCTGATATTATTTCTTCTATCAGCTACTTCTTCAACCTCCTGCACGGAGTGGGCGAC
ACTGATGATATCGACCATCTCGGAAACCGCCGTCTGCGTTCTGTAGGTGAGCTCCTGCAAAACCAATTCCGTATCGGTTT
AAGCCGGATGGAACGTGTCGTACGTGAAAGAATGTCTATTCAAGACACAAATACAATTACGCCGCAGCAGCTGATTAACA
TCAGACCTGTTATTGCATCTATTAAAGAGTTCTTTGGAAGCTCACAGCTTTCTCAATTCATGGATCAGACGAACCCGCTT
GCTGAATTGACGCACAAACGCCGTCTGTCAGCTCTCGGACCGGGCGGTTTGACACGTGAGCGCGCAGGTATGGAAGTACG
TGACGTTCACTACTCTCACTATGGCCGTATGTGTCCGATTGAAACGCCTGAGGGCCCGAACATCGGTTTGATCAACTCAT
TGTCATCATTTGCGAAAGTAAACCGCTTTGGTTTCATTGAGACGCCATACCGCCGCGTTGATCCTGAAACAGGAAAAGTA
ACGCCTAGAATCGACTACCTGACTGCTGATGAAGAGGATAACTATGTCGTAGCCCAAGCGAATGCTAAGCTGAGCGATGA
CGGTTCTTTCTTGGATGACAGCATCGTAGCGCGTTTCAGAGGGGAAAACACCGTTGTAGCCCGCAACCGCGTGGATTACA
TGGACGTATCTCCTAAACAGGTTGTATCTGCTGCGACAGCATGTATTCCGTTCTTGGAAAACGATGACTCGAACCGCGCC
CTCATGGGAGCGAACATGCAGCGTCAGGCTGTGCCTTTGATGCAGCCGGAAGCTCCGATCGTCGGAACGGGTATGGAATA
CGTATCCGGTAAAGACTCCGGTGCAGCCGTTATTTGTAAACACCCTGGTATCGTTGAACGGGTGGAAGCGAAAAACGTAT
GGGTGCGCCGCTATGAAGAAATTGACGGCCAAAAAGTAAAAGGCAACCTGGATAAGTACAGCTTGCTGAAATTTGTCCGC
TCCAACCAAGGTACGTGCTACAACCAGCGTCCGATCGTCAGTGTCGGCGATGAAGTAGTCAAAGGAGAAATCCTTGCTGA
CGGACCTTCAATGGAGCTTGGTGAACTTGCTCTCGGCCGCAACGTAATGGTCGGCTTCATGACATGGGATGGTTACAACT
ATGAGGATGCCATCATCATGAGTGAACGCCTTGTGAAAGATGATGTATACACATCTATTCACATTGAAGAATATGAATCA
GAAGCACGTGATACAAAGCTTGGGCCGGAAGAGATCACCCGTGATATTCCAAACGTAGGGGAAGACGCGCTTCGCAATCT
TGATGACCGCGGAATTATCCGTATCGGTGCGGAAGTCAACGACGGAGACCTTCTCGTAGGTAAAGTAACGCCTAAAGGTG
TAACTGAGCTTACGGCTGAAGAACGCCTTCTGCATGCGATCTTTGGAGAAAAAGCGCGTGAAGTCCGTGATACTTCTCTC
CGTGTGCCTCACGGCGGCGGCGGAATTATCCACGACGTAAAAGTCTTCAACCGTGAAGACGGCGACGAACTTCCTCCGGG
AGTGAACCAGCTTGTACGCGTATATATCGTTCAGAAACGTAAGATTTCTGAAGGTGATAAAATGGCCGGACGTCACGGAA
ACAAAGGGGTTATCTCGAAGATTCTTCCTGAAGAAGATATGCCTTACCTTCCTGACGGCACGCCGATCGATATCATGCTT
AACCCGCTGGGTGTACCATCACGTATGAATATCGGTCAGGTATTAGAACTTCACATGGGTATGGCTGCCCGCTACCTCGG
CATTCACATCGCGTCACCTGTATTTGACGGCGCGCGTGAAGAAGATGTGTGGGAAACACTTGAAGAAGCAGGCATGTCAA
GAGACGCTAAAACAGTTCTTTATGACGGCCGTACGGGAGAACCGTTTGACAACCGTGTATCTGTCGGAATCATGTACATG
ATCAAACTGGCACACATGGTTGATGATAAACTTCATGCCCGTTCTACAGGTCCTTACTCACTTGTTACGCAGCAGCCTCT
CGGCGGTAAAGCCCAATTCGGCGGACAGCGTTTCGGTGAGATGGAGGTTTGGGCGCTTGAAGCTTACGGCGCAGCTTACA
CGCTTCAAGAAATCCTGACTGTGAAGTCCGATGACGTGGTCGGACGTGTGAAAACATATGAAGCCATCGTCAAAGGCGAC
AATGTTCCAGAGCCTGGTGTTCCGGAATCATTCAAAGTATTGATCAAAGAGCTTCAAAGCTTAGGTATGGACGTGAAAAT
CCTTTCAGGCGATGAAGAAGAAATAGAAATGAGAGATCTAGAAGACGAGGAAGATGCGAAACAAGCTGACGGCCTTGCAT
TATCAGGTGATGAAGCGCCGGAAGAAACAGCATCTCCAGACGTTGAACGTGACGCAGTAACGAAAGAGTAG

>Rif|NC_002953.2862188|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGCGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAACACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGCGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATACATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGACGGACGTCCGATCGATATCATGTTAAACCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGCGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGAGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGTAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>Rif|NC_002758.1120515|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGTGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTACGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTTAATCAAAAATTAGCTGAGCCAA
TTGTAAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAATGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GCATTACACCAGCAGATATCATTGCTTCAATGAGTTACTTCTTTAACTTATTAAGCGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAACCCATTAGCTGAGTTAACG
TATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTACGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACACCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAACGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGAACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTATAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGATACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATCGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>CARD|pvgb|NC_002695|4990140-4994169|ARO:3003288|Escherichia|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTACCTTATCT
CCTTTCTATCCAGCTTGACTCGTTTCAGAAATTTATCGAGCAAGATCCTGAAGGGCAGTATGGTCTGGAAGCTGCTTTCC
GTTCCGTATTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAATACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTCCAGGAATGTCAAATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTTAAACTGCGTCTGGTGATCTATGAGCG
CGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACAGACAACG
GTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGAC
AAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGCATCATCCCTTACCGTGGTTCCTGGCTGGACTTCGA
ATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATTCTGCGTGCCCTGA
ACTACACCACAGAGCAGATCCTCGACCTGTTCTTTGAAAAAGTTATCTTTGAAATCCGTGATAACAAGCTGCAGATGGAA
CTGGTGCCGGAACGCCTGCGTGGTGAAACCGCATCCTTTGACATCGAAGCTAACGGTAAAGTGTACGTAGAAAAAGGCCG
CCGTATCACTGCGCGCCACATTCGCCAGCTGGAAAAAGACGACGTCAAACTGATCGAAGTCCCGGTTGAGTACATCGCAG
GTAAAGTGGTTGCTAAAGACTATATTGATGAGTCTACCGGCGAGCTGATCTGCGCAGCGAACATGGAGCTGAGCCTGGAT
CTGCTGGCTAAGCTGAGCCAGTCTGGTCACAAGCGTATCGAAACGCTGTTCACCAATGATCTGGATCACGGCCCGTATAT
CTCTGAAACCTTACGTGTCGACCCAACTAACGACCGTCTGAGCGCACTGGTAGAAATCTACCGCATGATGCGCCCTGGCG
AGCCGCCGACTCGTGAAGCAGCGGAAAGCCTGTTCGAGAACCTGTTCTTCTCCGAAGACCGTTATGACCTGTCTGCGGTT
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGAAGAAATCGAAGGTTCTGGTATCCTGAGCAAAGACGACATCATTGA
TGTTATGAAAAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTCGATGATATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAAGCCGATTTCCGCAGCAGTGAAAGAGTTCTTCGG
TTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCG
GCCCAGGCGGTCTGACCCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCA
ATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGCACAGACTAACGAATACGGCTTCCT
TGAGACTCCGTATCGTAAAGTGACTGACGGTGTTGTAACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACT
ACGTTATCGCCCAGGCGAACTCCAACCTGGATGAAGAAGGCCACTTCGTAGAAGACCTGGTAACCTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGTGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCGACTCTGC
GTGCTGATAAGCCGCTGGTTGGTACTGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTAACTGCGGTTGCTAAACGT
GGTGGTGTCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGTGAAGCAGG
TATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATTAACCAGATGCCGTGTGTGTCTCTGG
GTGAACCGGTTGAACGTGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTTGGTCAGAACATG
CGCGTAGCGTTCATGCCGTGGAATGGTTACAACTTCGAAGACTCCATCCTCGTATCCGAGCGTGTTGTTCAGGAAGACCG
TTTCACCACCATCCACATTCAGGAACTGGCGTGTGTGTCCCGTGACACCAAGCTGGGGCCAGAAGAGATCACCGCTGACA
TCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTATATTGGTGCGGAAGTGACCGGTGGC
GACATTCTGGTTGGTAAGGTTACGCCGAAAGGTGAAACTCAGCTGACCCCAGAAGAAAAACTGCTGCGTGCGATCTTCGG
TGAGAAAGCGTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTATCCGGTACGGTTATCGACGTTCAGGTCT
TTACTCGCGATGGCGTAGAAAAAGACAAACGTGCGCTGGAAATCGAAGAAATGCAGCTCAAACAGGCGAAGAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCCGTGCTGTGCTGGTAGCCGGTGGCGTTGAAGCTGA
GAAGCTCGACAAATTGCCGCGCGATCGCTGGCTGGAGCTGGGCCTGACCGACGAAGAGAAACAAAATCAGCTGGAACAGC
TGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGAC
GATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCGGTTAAACGCCGTATCCAGCCTGGTGACAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTAATTTCTAAGATCAACCCGATCGAAGATATGCCTTACGATGAAAACGGTACGCCGG
TAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATCCTCGAAACCCACTTGGGTATGGCT
GCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAAACAGCAGCAGGAAGTCGCGAAACTGCGTGAATTCATCCAGCG
TGCGTACGATCTGGGCGCTGACGTTCGTCAGAAAGTTGACCTGAGTACCTTCAGCGATGAAGAAGTTATGCGTCTGGCTG
AAAACCTGCGCAAAGGTATGCCAATCGCAACGCCGGTGTTCGACGGTGCGAAAGAAGCAGAAATTAAAGAGCTGCTGAAA
CTTGGCGACCTGCCGACTTCTGGTCAGATCCGCCTGTACGACGGCCGCACTGGTGAACAGTTCGAACGTCCGGTAACCGT
TGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAGATGCACGCGCGTTCCACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGTTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCA
TACGGCGCAGCATACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACTAAGATGTATAAAAA
CATCGTGGACGGCAACCATCAGATGGAGCCGGGCATGCCAGAATCCTTCAACGTATTGTTGAAAGAGATTCGTTCGCTGG
GTATCAACATCGAACTGGAAGACGAGTAAT

>Rif|AL009126.3|gene138|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
TTGACAGGTCAACTAGTTCAGTATGGACGACACCGCCAGCGCAGAAGCTATGCTCGCATTAGCGAAGTGTTAGAATTACC
AAATCTCATTGAAATTCAAACCTCTTCTTATCAGTGGTTTCTTGATGAGGGTCTTAGAGAGATGTTTCAAGACATATCAC
CAATTGAGGATTTCACTGGTAACCTCTCTCTTGAGTTCATTGATTATAGTTTAGGTGAGCCTAAATATCCTGTAGAGGAA
TCAAAAGAACGTGATGTGACTTACTCAGCTCCGCTAAGAGTGAAGGTTCGTTTAATTAACAAAGAAACTGGAGAGGTAAA
AGACCAAGATGTCTTCATGGGTGATTTCCCTATTATGACAGATACAGGTACTTTTATCATTAACGGTGCGGAACGTGTTA
TCGTTTCCCAGCTTGTTCGGTCTCCAAGTGTATATTTCAGTGGTAAAGTAGACAAAAACGGTAAAAAAGGTTTTACCGCA
ACTGTCATTCCAAACCGTGGCGCATGGTTAGAATACGAAACTGATGCGAAAGATGTTGTTTATGTCCGCATTGATCGCAC
ACGTAAGTTGCCGGTTACGGTTCTTTTGCGTGCTCTCGGCTTCGGCTCCGATCAAGAGATTCTTGATCTCATAGGAGAAA
ACGAATACCTGCGAAATACGCTTGATAAAGATAACACAGAAAACAGCGACAAAGCGTTGCTGGAAATTTACGAGCGTCTC
CGTCCTGGAGAGCCGCCTACAGTAGAAAATGCGAAAAGCTTGCTTGATTCTCGTTTCTTTGATCCGAAACGATACGATCT
TGCCAATGTAGGACGCTATAAAATTAATAAAAAACTTCATATTAAGAATCGCCTCTTCAATCAGAGACTTGCTGAAACGC
TTGTTGATCCTGAAACAGGAGAAATCCTTGCTGAAAAAGGCCAGATTCTTGATAGAAGAACGCTTGATAAAGTACTGCCA
TACTTAGAAAACGGAATCGGTTTTAGAAAGCTGTATCCGAATGGCGGCGTTGTTGAAGATGAAGTGACTCTTCAATCAAT
TAAAATCTTTGCTCCGACTGATCAAGAAGGAGAACAGGTTATCAATGTAATCGGCAATGCTTACATCGAAGAAGAGATTA
AAAACATCACGCCTGCTGATATTATTTCTTCAATCAGCTACTTCTTCAACCTGCTGCACGGAGTAGGCGACACAGATGAT
ATCGATCATCTTGGAAACCGCCGTTTACGTTCTGTAGGCGAGCTTCTCCAGAACCAATTCCGTATCGGTTTAAGCCGTAT
GGAGCGTGTGGTTCGTGAGAGAATGTCAATTCAAGATACGAATACAATTACGCCTCAGCAGCTGATCAATATTCGTCCTG
TTATTGCGTCCATTAAAGAGTTCTTTGGAAGCTCACAGCTTTCTCAATTCATGGATCAGACGAACCCGCTTGCTGAATTA
ACGCACAAGCGTCGTCTGTCAGCATTAGGACCGGGCGGATTGACACGTGAGCGTGCCGGAATGGAAGTGCGTGACGTTCA
CTACTCCCACTATGGCCGTATGTGTCCGATTGAAACGCCTGAGGGCCCGAACATCGGTTTGATCAACTCACTATCATCTT
ATGCAAAAGTAAACCGTTTTGGCTTTATTGAAACGCCATATCGCCGCGTTGACCCTGAAACAGGGAAGGTAACGGGCAGA
ATCGATTACTTAACTGCTGATGAAGAGGATAACTATGTTGTCGCTCAAGCGAATGCTCGTCTTGATGACGAAGGCGCCTT
TATTGATGACAGCATCGTAGCTCGTTTCCGCGGGGAGAACACCGTTGTTTCCAGAAATCGTGTAGACTACATGGATGTAT
CGCCTAAGCAGGTTGTATCTGCTGCGACAGCATGTATCCCGTTCTTAGAAAACGATGACTCCAACCGTGCCCTCATGGGA
GCGAACATGCAGCGTCAGGCTGTGCCTTTGATGCAGCCGGAAGCGCCATTTGTTGGAACTGGTATGGAATACGTATCAGG
AAAAGACTCTGGTGCCGCTGTTATTTGTAAACACCCTGGTATCGTTGAACGCGTAGAAGCCAAAAACGTTTGGGTTCGCC
GTTATGAAGAAGTAGACGGTCAAAAAGTAAAAGGAAACCTGGATAAATACAGCCTGCTGAAATTTGTCCGCTCTAACCAA
GGTACGTGCTACAACCAGCGTCCGATCGTAAGTGTCGGCGATGAAGTGGTAAAAGGAGAAATCCTTGCTGACGGTCCTTC
TATGGAGCTTGGTGAACTTGCACTTGGCCGTAACGTAATGGTCGGCTTCATGACGTGGGATGGCTACAACTATGAGGATG
CCATCATCATGAGTGAACGCCTAGTGAAGGATGATGTTTATACATCTATCCACATTGAAGAATACGAATCAGAAGCACGT
GATACGAAACTTGGACCTGAAGAAATCACTCGCGATATTCCAAACGTCGGTGAAGATGCGCTTCGCAATCTTGATGACCG
CGGAATCATCCGTATTGGGGCAGAAGTAAAAGACGGAGATCTTCTTGTTGGTAAAGTAACGCCTAAAGGCGTAACTGAAC
TGACTGCCGAAGAACGCCTTCTTCACGCCATCTTTGGCGAGAAAGCCCGCGAGGTTCGTGATACTTCTCTTCGTGTGCCT
CATGGCGGCGGCGGAATTATCCATGACGTTAAAGTCTTCAACCGTGAAGACGGAGACGAACTTCCTCCAGGTGTTAACCA
GTTAGTACGCGTATATATCGTTCAGAAACGTAAGATTTCTGAAGGGGATAAAATGGCCGGTCGTCACGGTAACAAAGGTG
TTATCTCTAAGATTCTTCCTGAAGAGGATATGCCTTACCTTCCTGACGGCACACCAATTGATATCATGCTTAACCCGCTG
GGCGTACCATCACGTATGAACATCGGGCAGGTATTGGAACTTCACATGGGTATGGCCGCTCGTTACCTTGGCATTCACAT
TGCATCTCCTGTATTTGACGGAGCGCGAGAAGAGGATGTCTGGGAAACACTTGAAGAAGCCGGCATGTCTCGTGACGCCA
AAACAGTGCTTTACGACGGACGTACTGGAGAGCCGTTTGATAACCGTGTATCTGTCGGTATCATGTACATGATCAAACTG
GCTCACATGGTTGACGATAAACTTCATGCACGCTCTACAGGCCCTTACTCACTTGTTACGCAGCAGCCTCTTGGCGGTAA
AGCGCAATTTGGCGGACAGCGTTTTGGTGAGATGGAGGTTTGGGCACTTGAAGCTTACGGTGCGGCTTACACTCTTCAAG
AAATTCTGACTGTTAAGTCTGATGACGTGGTTGGACGTGTGAAAACATACGAAGCCATCGTTAAAGGCGACAATGTTCCT
GAACCAGGTGTTCCGGAATCATTCAAAGTATTAATCAAAGAACTTCAAAGCTTAGGTATGGATGTCAAAATCCTTTCTGG
TGATGAAGAAGAAATAGAAATGAGAGATTTAGAAGACGAAGAAGATGCGAAACAAGCTGACGGCCTGGCATTATCAGGTG
ATGAAGAGCCGGAAGAAACAGCATCTGCAGACGTTGAACGCGATGTAGTAACAAAAGAATAA

>Rif|AP009048.1|gene3341|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTACCTTATCT
CCTTTCTATCCAGCTTGACTCGTTTCAGAAATTTATCGAGCAAGATCCTGAAGGGCAGTATGGTCTGGAAGCTGCTTTCC
GTTCCGTATTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAATACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTCCAGGAATGTCAAATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTTAAACTGCGTCTGGTGATCTATGAGCG
CGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACAGACAACG
GTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGAC
AAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGTATCATCCCTTACCGTGGTTCCTGGCTGGACTTCGA
ATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATTCTGCGCGCCCTGA
ACTACACCACAGAGCAGATCCTCGACCTGTTCTTTGAAAAAGTTATCTTTGAAATCCGTGATAACAAGCTGCAGATGGAA
CTGGTGCCGGAACGCCTGCGTGGTGAAACCGCATCTTTTGACATCGAAGCTAACGGTAAAGTGTACGTAGAAAAAGGCCG
CCGTATCACTGCGCGCCACATTCGCCAGCTGGAAAAAGACGACGTCAAACTGATCGAAGTCCCGGTTGAGTACATCGCAG
GTAAAGTGGTTGCTAAAGACTATATTGATGAGTCTACCGGCGAGCTGATCTGCGCAGCGAACATGGAGCTGAGCCTGGAT
CTGCTGGCTAAGCTGAGCCAGTCTGGTCACAAGCGTATCGAAACGCTGTTCACCAACGATCTGGATCACGGCCCATATAT
CTCTGAAACCTTACGTGTCGACCCAACTAACGACCGTCTGAGCGCACTGGTAGAAATCTACCGCATGATGCGCCCTGGCG
AGCCGCCGACTCGTGAAGCAGCTGAAAGCCTGTTCGAGAACCTGTTCTTCTCCGAAGACCGTTATGACTTGTCTGCGGTT
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGAAGAAATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATTGA
TGTTATGAAAAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTCGATGATATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCACAGGATATGATCAACGCCAAGCCGATTTCCGCAGCAGTGAAAGAGTTCTTCGG
TTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCG
GCCCAGGCGGTCTGACCCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCA
ATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGCACAGACTAACGAATACGGCTTCCT
TGAGACTCCGTATCGTAAAGTGACCGACGGTGTTGTAACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACT
ACGTTATCGCCCAGGCGAACTCCAACTTGGATGAAGAAGGCCACTTCGTAGAAGACCTGGTAACTTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCGACTCTGC
GCGCTGATAAGCCGCTGGTTGGTACTGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTAACTGCGGTAGCTAAACGT
GGTGGTGTCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGTGAAGCAGG
TATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATCAACCAGATGCCGTGTGTGTCTCTGG
GTGAACCGGTTGAACGTGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTTGGTCAGAACATG
CGCGTAGCGTTCATGCCGTGGAATGGTTACAACTTCGAAGACTCCATCCTCGTATCCGAGCGTGTTGTTCAGGAAGACCG
TTTCACCACCATCCACATTCAGGAACTGGCGTGTGTGTCCCGTGACACCAAGCTGGGTCCGGAAGAGATCACCGCTGACA
TCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTACATTGGTGCGGAAGTGACCGGTGGC
GACATTCTGGTTGGTAAGGTAACGCCGAAAGGTGAAACTCAGCTGACCCCAGAAGAAAAACTGCTGCGTGCGATCTTCGG
TGAGAAAGCCTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTATCCGGTACGGTTATCGACGTTCAGGTCT
TTACTCGCGATGGCGTAGAAAAAGACAAACGTGCGCTGGAAATCGAAGAAATGCAGCTCAAACAGGCGAAGAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCCGTGCTGTGCTGGTAGCCGGTGGCGTTGAAGCTGA
GAAGCTCGACAAACTGCCGCGCGATCGCTGGCTGGAGCTGGGCCTGACAGACGAAGAGAAACAAAATCAGCTGGAACAGC
TGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGAC
GATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCGGTTAAACGCCGTATCCAGCCTGGTGACAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTAATTTCTAAGATCAACCCGATCGAAGATATGCCTTACGATGAAAACGGTACGCCGG
TAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATCCTCGAAACCCACCTGGGTATGGCT
GCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAAACAGCAGCAAGAAGTCGCGAAACTGCGCGAATTCATCCAGCG
TGCGTACGATCTGGGCGCTGACGTTCGTCAGAAAGTTGACCTGAGTACCTTCAGCGATGAAGAAGTTATGCGTCTGGCTG
AAAACCTGCGCAAAGGTATGCCAATCGCAACGCCGGTGTTCGACGGTGCGAAAGAAGCAGAAATTAAAGAGCTGCTGAAA
CTTGGCGACCTGCCGACTTCCGGTCAGATCCGCCTGTACGATGGTCGCACTGGTGAACAGTTCGAGCGTCCGGTAACCGT
TGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAGATGCACGCGCGTTCCACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGTTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCA
TACGGCGCAGCATACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACCAAGATGTATAAAAA
CATCGTGGACGGCAACCATCAGATGGAGCCGGGCATGCCAGAATCCTTCAACGTATTGTTGAAAGAGATTCGTTCGCTGG
GTATCAACATCGAACTGGAAGACGAGTAA

>Rif|CP001581.1|gene3846|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTACATCCTGTCCAAGTTGGCAAAAGGACTCGTATGAGCTTTTCTAGGCTTAAAGAGGTTGGTCAAATGCCAAACCT
TATAGAAGTTCAGTTAGACTCATATGATTGGTTTTTAAAAGAAGGGTTACAAGAAGTTTTTGACGATATTAACCCGATTC
AAGATTATACAGGTAATCTAAATTTAGAATTTGTAGGTTACAAACTGGATTTAGATAGTATTAAGTACTCTGTTGAAGAG
TGTAAAGAAAGAGATTCTACTTATGCAGCACCATTAAAAGTAAAAGTTAGACTTTTAAATAAGGAAACTGGCGAAATAAA
AGAACAAGAAGTTTTTATGGGAGACTTCCCTTTAATGACAGAACAAGGAACCTTTATAATAAATGGTGCAGAAAGAGTTA
TAGTAAGCCAATTAGTTAGATCACCAGGGGTTTATTATGACATGACTGTAGATAAAACAGGAAGTAAATTATTTTCAGCT
ACAGTTATACCTAACAGAGGTGCATGGTTAGAATATGAAACAGATTCAAATAACATAATATATGTAAGAATTGACAAGAC
ACGAAAATTACCAATTACTATATTAGCAAGAGCATTAGGTTATGGAACAGATGCTGAAATAATAGAATTTTTCGGAGAAG
ATGAAAGATTAAAAGCAACAATAGAAAAAGATAACACTAAGACTAGAGAAGAGGCTTTACTTGAAATATATAAGAGATTA
AGACCAGGTGAACCACCTACTGTGGATAGTGCAGAATCTTTAATTGAATCTTTATTCTTCGATGCTAAAAGATATGATTT
ATCAAGAGTTGGAAGATATAAATTTAATAAAAAATTAGCAATCCATTTAAGAATAACAAATCAAATTGCAGATCAAGATA
TAGTTAATCCACAAACAGGAGAAATTTTAGTACAAAAAGGTGAAAAAATAGATAAAGATAAAGCTATTGAAATACAAAAC
TGTGGCATTAACGAAGTATATATCAAAATAGATGATAAGTCATTTAAAGTAATTGGCAATCACTTTGTAGACATACATAG
TTTGGTTCCATTCGATATAAGTGATTTAAATATTAAGGAATATGTATTCTATCCTGTTTTAAAAGAAATACTAGATAATT
ATGCTGATGAAGAAAGTATAAAAGAAGAAATAAGAAAGAATATATATAGATTAATTCCTAAACATATTATAAGAGAAGAT
ATATATGCTACCATAAATTATGAACTAGGATTAAGTTATGATATTGGTTATAAAGATGATATAGATCATTTAGGAAATAG
AAGGCTGAGATCAGTAGGAGAATTATTACAAAATCAATTTAGAATTGGTTTATCTAGAATGGAAAGAGTTGTTAAAGAAA
GAATGACAATTCAAGATCAAGAAGTAATAACTCCTCAAGCTTTAATAAATATTAGACCTGTAGCTGCATCCATTAAAGAA
TTTTTTGGTAGTTCACAATTATCACAATTTATGGATCAAACAAATCCTCTATCAGAATTAACACATAAAAGAAGGTTATC
AGCTCTAGGACCAGGAGGACTTTCAAGAGAAAGGGCAGGTTTTGAGGTAAGAGACGTTCACCATTCACATTATGGAAGAA
TGTGTCCTATAGAAACTCCAGAAGGACCCAATATAGGTCTTATAAATTCTTTAGCTACATTTGCTAAAGTTAATGAATAT
GGATTTATAGAAACACCATATAGAAGAATAGATCCTAAGAATAAAAGAGCCACAAATGATATAGTATATATGACAGCGGA
TGAAGAAGATTTATACGTAATAGCTAGATCAGATGAACCAATTGATGAAAATGGATATTTTATAGATGATAAGGTTACAG
TTAGGGCTAAAGAGGAAGTTTTAGTTGTTCCAGTTAGCGAAGTTGAGTATATGGATATATCACCAAGACAATTGGTTTCT
GTTGCAACTGCAATGATACCATTCCTTGAAAATGATGATGCCAGCCGTGCACTTATGGGATCAAACATGCAACGTCAAGC
AGTACCACTATTAAAGCCACAGGCTCCAATAGTTGGAACAGGTATAGAATATAAAGCTGCAACGGATTCAGGGGTTCTTC
CAAAGGCTAAAAATGCAGGGACAGTAGTATATGTTTCAGCAGATGAAATAAGAGTAAGACGAGATAGCGATGGAGGAATA
GATAAATATAAATTATTAAAATTCAAAAGATCTAACCAAGGAACATGTATAAATCAAAGACCAATTGTTTCTAAAGGTGA
AGTAGTAGCTAAGGAAACTCTATTAGCAGATGGACCTTCTACAGATCTTGGAGAAATAGCACTTGGTAAAAATATTCTTA
TGGGCTTTATAACATGGGAAGGATATAATTACGAAGATGCCATGTTAATTTCAGAGCAATTAGTAAAAGAAGATGTGTTT
ACATCTATACACATAGAAGAATATGAAGCTGAAGCTAGGGACACAAAACTAGGACCAGAAGAGATAACAAGAGATATACC
TAACGTAGGAGAAGAAGCGCTTAAAGATATAGATGAAAGAGGTATCATTAGAATTGGTGCTGAAGTTAGATCAGGAGATA
TATTAGTAGGTAAAGTTACTCCAAAGGGAGAAACTGAACTAACAGCTGAAGAAAGATTACTTCGTGCTATATTTGGAGAA
AAAGCAAGAGAGGTTAGAGATACATCACTCAGAGTTCCACATGGAGAAGCAGGAATTATAGTTGATGTTAAAATATTTAC
AAGAGAAAATGGTGATGAATTACCACCAGGAGTTAATAAATTAGTTAGATGCTATATAGCTCAAAAGAGAAAAATATCTG
TTGGAGATAAGATGGCAGGAAGACATGGTAATAAAGGGGTTATCTCTAGAGTTTTACCAGAAGAAGATATGCCATTCTTA
CCAGATGGAAGACCACTTCAAATATGCTTAAATCCTTTAGGGGTACCATCACGTATGAATATAGGTCAGGTGTTAGAAGT
ACATTTAGGGTTAGCCGCTAGTAAATTAGGCTGGCATATAGCTACACCGGTTTTCGATGGGGCAATAGAATCTGACATAG
TAGATTGTTTAAGAAAAGCTGGTTATTCTGAAGATGGAAAAACTGTTCTATATGATGGAAGAACAGGAGAACCATTTGAT
AATAGAGTAACAGTAGGATATATGTATATTTTAAAACTAGCTCATTTAGTTGATGATAAAATACATGCTAGATCTACAGG
CCCATACTCACTAGTAACTCAACAACCTCTTGGAGGTAAAGCTCAGTTTGGAGGACAAAGATTTGGTGAGATGGAGGTTT
GGGCTTTAGAAGCTTACGGAGCAGCTCATACTCTTCAAGAAATATTAACAGTTAAATCAGATGATGTAGTTGGAAGAGTT
AAGACTTATGAAGCTATAGTAAAGGGAGAAAATATTCCAGAACCTGGAGTTCCTGAATCTTTCAAAGTTTTAATAAAAGA
ATTACAAGCATTATGTTTAGATGTTAAGGTATTGAATGATGATAATCAGGAAATAAAATTAAAGGAATCTGTGGATGAAG
ATGCAGACGAATTAGAAGTAAATATAGAAGGTACAGAAAATCAACCAGAAGAGAAAGAAGAAAAAGAAAAAGAAGATAGT
GATGAATATGATGACTTAAGAGAAGAGGACGTAGAACCAGATTTAGAAGAGTTATCATTAGATGACTTAGATTTAGATGA
TTTTGGTGATGAACATTAA

>Rif|NC_003197.1.1255679|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGTTTACTCCTATACCGAGAAAAAACGTATTCGTAAGGATTTTGGTAAACGTCCACAAGTTCTGGATGTACCTTATCT
CCTTTCTATCCAGCTTGACTCGTTTCAGAAGTTTATCGAGCAAGATCCTGAAGGGCAGTACGGCCTGGAAGCAGCCTTCC
GTTCCGTGTTCCCGATTCAGAGCTACAGCGGTAATTCCGAGCTGCAGTACGTCAGCTACCGCCTTGGCGAACCGGTGTTT
GACGTTCAGGAATGTCAGATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTAAAACTGCGTCTGGTGATCTACGAGCG
CGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACCGACAACG
GTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCTCAGCTGCACCGTAGCCCTGGCGTCTTCTTTGACTCCGAC
AAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGCATCATTCCTTACCGTGGTTCCTGGCTGGACTTCGA
ATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTACCTGCGACCATCATCCTGCGTGCGCTGA
ACTACACCACTGAGCAGATCCTTGACCTGTTCTTTGAGAAAGTCGTCTTCGAAATTCGCGACAACAAACTGCAGATGGAG
CTGATTCCAGAACGTCTGCGTGGCGAAACCGCGTCGTTCGATATCGAAGCTAACGGCAAAGTGTACGTTGAAAAAGGCCG
TCGCATTACCGCGCGTCACATCCGTCAGCTGGAAAAAGACGATATCAAGCATATCGAAGTTCCGGTTGAGTACATCGCAG
GTAAAGTCGTCTCTAAAGACTACGTTGACGAATCTACTGGCGAGCTGATCTGCGCGGCGAACATGGAGCTGAGCCTGGAT
CTGCTGGCTAAGCTGAGCCAGTCCGGCCACAAGCGTATCGAAACGCTGTTTACCAACGATCTGGACCACGGCCCGTACAT
TTCTGAAACGGTACGCGTCGACCCAACTAACGATCGTCTGAGCGCGCTGGTAGAAATCTACCGCATGATGCGCCCTGGTG
AGCCGCCGACACGCGAAGCGGCTGAAAGCCTGTTTGAGAACCTGTTCTTCTCCGAAGACCGCTATGACCTGTCTGCGGTG
GGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGACGAAATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATTGA
TGTCATGAAGAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTGGATGATATCGACCACCTCGGCAACCGTCGTATCC
GTTCCGTCGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTGCGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCT
CTGGGCGATCTGGATACCCTGATGCCTCAGGATATGATCAACGCCAAGCCGATTTCCGCCGCAGTGAAAGAGTTCTTTGG
TTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCG
GCCCAGGCGGTCTGACCCGCGAACGCGCAGGCTTCGAAGTTCGAGACGTACACCCGACGCACTACGGTCGCGTATGTCCT
ATCGAAACGCCGGAAGGTCCGAACATCGGTCTGATCAACTCCCTGTCCGTGTACGCACAGACTAACGAATATGGCTTCCT
TGAGACGCCGTACCGTCGTGTGGTTGATGGCGTGGTTACTGACGAAATTCATTACCTGTCTGCTATCGAAGAAGGCAACT
ACGTTATCGCTCAGGCGAACTCCAACCTGGATGACGAAGGCCACTTTGTAGAAGATTTGGTGACCTGCCGTAGCAAAGGC
GAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTTTCCACCCAGCAGGTGGTCTCCGTCGGTGCGTCCCT
GATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCGGTTCCGACTCTGC
GCGCTGACAAGCCGCTGGTGGGTACCGGTATGGAACGTGCTGTCGCCGTCGACTCCGGTGTTACTGCAGTAGCTAAACGT
GGCGGTACTGTTCAGTACGTGGATGCGTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTACCCGGGCGAAGCGGG
TATCGACATCTATAACCTGACCAAATACACCCGCTCTAACCAGAACACCTGTATCAACCAGATGCCATGTGTGTCTCTGG
GCGAGCCGGTTGAACGCGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTCGGTCAGAACATG
CGCGTGGCGTTCATGCCGTGGAACGGCTACAACTTCGAAGACTCCATTCTCGTTTCCGAGCGTGTTGTCCAGGAAGACCG
TTTCACCACCATCCACATTCAGGAACTGGCGTGCGTGTCCCGTGACACCAAGCTGGGGCCGGAAGAGATCACCGCTGATA
TCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTACATCGGCGCGGAAGTGACAGGCGGT
GACATTCTGGTCGGTAAGGTGACGCCGAAAGGTGAAACCCAGCTGACGCCGGAAGAGAAACTGCTGCGTGCGATCTTCGG
TGAGAAAGCGTCTGACGTTAAAGACTCTTCTCTGCGCGTACCTAACGGTGTCTCCGGTACGGTTATCGACGTTCAGGTCT
TTACTCGCGATGGCGTAGAAAAAGACAAACGTGCTCTGGAAATCGAAGAGATGCAGCTCAAGCAGGCGAAAAAAGACCTG
TCTGAAGAACTGCAGATCCTCGAAGCGGGCCTGTTTAGCCGTATCCGTGCGGTGCTGGTTTCCAGCGGCGTTGAAGCTGA
GAAGCTCGACAAACTGCCGCGCGACCGCTGGCTGGAACTCGGTCTGACCGACGAAGAGAAACAAAATCAGCTGGAACAAC
TGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAAAAACTTGAAGCGAAGCGCCGTAAAATCACCCAGGGCGAC
GATCTGGCGCCGGGCGTGCTGAAGATCGTGAAGGTCTATCTGGCCGTTAAACGCCGTATCCAGCCGGGTGATAAGATGGC
AGGTCGTCACGGTAACAAGGGTGTTATCTCTAAGATCAACCCGATCGAAGACATGCCTTACGATGAAAACGGCACGCCGG
TAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGCCAGATTCTGGAAACCCACCTGGGTATGGCT
GCGAAAGGTATTGGCGACAAGATTAACGCCATGCTGAAACAGCAGCAGGAAGTCGCGAAACTGCGCGAATTCATCCAGCG
TGCCTACGATCTGGGCGCCGACGTTCGTCAGAAAGTCGACCTGAGCACCTTCAGCGATGATGAAGTGCTGCGTCTGGCAG
AAAACCTGCGCAAAGGTATGCCGATTGCCACACCAGTGTTTGACGGTGCGAAAGAAGCGGAAATCAAAGAGCTGCTGAAA
CTGGGCGACCTGCCGACCTCCGGTCAGATCACCCTGTTCGATGGCCGTACGGGTGAACAGTTCGAACGTCCGGTAACCGT
CGGTTACATGTACATGCTGAAACTGAACCACCTGGTTGATGACAAGATGCATGCGCGTTCTACCGGTTCTTACAGCCTGG
TTACTCAGCAGCCGCTGGGTGGTAAGGCGCAGTTCGGTGGTCAGCGCTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCT
TACGGCGCCGCCTACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAATGGTCGTACCAAGATGTATAAGAA
CATCGTGGACGGCAACCATCAGATGGAACCGGGTATGCCGGAATCCTTCAACGTTCTGTTGAAAGAGATCCGCTCGCTGG
GCATCAACATCGAACTGGAAGACGAGTAA

>Rif|CP000675.2|gene392|Rifampin|Rifampin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOB|RequiresSNPConfirmation
ATGGCAGTTGCAGAAGCTAAACCTCAATATTCGCATGCTGAGAAAAAACGATTTCGCAAAAGCTTTGGTAAGCAGACAGA
TATAATGCCAATACCGAATCTGCTTGAAATTCAACTTAAATCCTACAGGGATTTTCTTCAAACTGATACTAAATTAAGCG
AACAACTGAATACGGGATTGCATGCTGCATTTTCTTCTGTATTTCCTATCGAAAGCTTTTCTGGTAATGCAAGACTTGAA
TACGTCGGATACAAGCTTGGAGAGCCTGCATTTGATGTTCGCGAATGCAAACTAAGAGGGCTGACTTACTCAGCTCCTCT
AAGAGTCAAGATCAGACTCGTTGTGCTTGATAAAGACGCAAGCGATGATCCTAAACCTATAAAGGATATTAGAGAGCAAG
ATGTTTTTATGGGGGAAATTCCTCTAATGACCGACGTTGGTACGTTTGTGGTCAATGGAACTGAACGTGTTGTTGTATCA
CAATTACATCGTTCGCCTGGGGTTATATTTGAACATGACAAGGGAAAAACTCACTCTTCAGGTAAATTGCTCTATTCTGC
ACGAATAATACCTTATCGTGGTTCATGGTTGGATTTTGAATTCGATCCTAAAGATTGCGTTTATGTACGTATTGACAGAC
GTCGCAAACTGCCAGTGACCATTTTGCTCAGAGCATTGGGCTACGAAGCAGAAGATATCTTAAGCGAATTTTTTGAAACA
ACTCGTTGTCATTTAAAAAATGGCGAATACCACATCGATTTAATTCCACAGCGTTTGCGTGGTGAAATCGCTTCATTCGA
TATTCATGTTCCTGAGACAGGAGAGCTTATCGTAGAACAAGGTCGTCGAATTACCGCAAGACATATAAAGCAAATGGAAA
AAAGCCAAATGCAGGATCTTGTGGTGCCAAGAGACTATTTAATTGGAAAAACATTAGCAAAAAATATTATTGATACCTCA
ACCGGTGAATTTCTGGCTCAAGCGAATGATGAGATAACGGAAGAGCTTTTAGATGCTATGGCTAACCATGGTATTTTACA
AATTGATATGATCTATACTAATGATTTGGATCATGGTTCTTACATATCGGATACATTAAAAATTGATCCCACAGGATCAC
AACTAGAAGCACTCGTTGAAATTTACCGCATGATGCGCCCTGGAGAGCCTCCTACAAAAGAAGCTGCTGAGGCACTGTTC
AAAAATCTATTCTTTGTTGAAGAAAGATATGATCTATCTGCTGTTGGCAGAATGAAATTTAATCGTCGCGTAGGAATTAA
GAGTGACGAAGGCCCAGGCACTTTAACGAAAGAAGATATTTTATCTGTCATTAAAACACTGATAGATATTCGAAACGGTA
TAGGGATGGTTGATGATATCGATCACCTAGGAAATCGTAGGGTAAGAAGTGTTGGCGAAATGACCGAAAATCAGTTTAGA
GTAGGTCTTGTTCGTGTTGAACGTGCTGTTAAAGAGCGTTTAAGTTTGGTTGAATCTGAAAATCTGATGCCACAGGACTT
AATTAACGCAAAACCAGTATCCGCCGCAATTAAAGAGTTTTTTGGATCCAGTCAGTTATCACAGTTTATGGATCAAGTGA
ATCCATTATCTGGTGTTACGCATAAAAGACGTGTATCGGCTCTTGGGCCAGGTGGTTTAACACGTGAGAGGGCTGGATTT
GAGGTCCGTGACGTACATACAACTCACTATGGTCGTGTGTGTCCAATTGAAACGCCTGAAGGACCAAATATTGGTCTAAT
CAATTCACTGTCAGTTTATGCAAGAACTAACGAATATGGATTTATTGAAACTCCTTGTCGAAAGGTCGTTAATGGGCGTG
TGACAGATGAAGTTGAATACCTATCGGCTATTGAGGAAGTTGATCAATACATTGCACAATCCAATGTTGAGTTAGACGCA
CAAGGAAATATTCTTGCTGACCTAGTTCCTTGCAGACATCAAAATGAATTTTCACTGACTACCCCGGATAAAATTAACTA
CATGGATGTCTCGCCCAAGCAAATTGTGTCAGTTGCTGCTTCATTGATTCCGTTTTTAGAGCACGATGACGCAAACAGAG
CATTAATGGGTTCAAACATGCAACGACAGGCTGTACCAACCTTGCGTTCAGAAAAGCCCTTGGTTGGGACCGGTATGGAA
AGAATTGTTGCATCTGATTCAGGGGTCTCAGTTGTTGCGAAGAGAGGTGGAGTTATTGATCTGGTTGATGCTTCTCGTAT
TGTTGTTCGAGTGAATGACGACGAAACAACAGCAGGGGAAACAGGGGTAGATATTTATAACTTAACCAAGTATTTCCGTT
CTAACCAGGATACTTGTATCAATCAAAGACCTATAGTATCAACAGGTGATCGAATTCAACGAGGCGATGTCCTGGCTGAT
GGTCCATGTACAGATATGGGTGAATTGGCTCTTGGACAGAATCTACTGGTAGCGTTTATGCCTTGGAATGGTTATAACTT
TGAGGATTCCATTCTTATATCTGAACGAATCGTTCATGACGACAGATTCACTACTATTCACATCGAAGAGTTAACATGTA
TAGCTCGAGATACCAAATTAGGTACAGAAGAAATTACAGCAGATATTCCCAATGTAGGCGAGTCTGCACTCTCCAATTTG
GATGAATCTGGAGTTGTTTACATCGGTGCAGAAGTAAAAGCAGGCGATATTCTTGTGGGTAAAGTAACTCCTAAAGGCGA
AACCCAACTAACTCCAGAAGAAAAACTGTTAAGAGCTATCTTTGGTGAAAAAGCTTCAGATGTTAAAGATTCATCTTTGA
GAGTTCCATCAGGCATGAATGGAACAGTGATCGATGTACAAGTCTTCACTCGTGATGGACTTGAAAAGGATGCCCGCGCT
AAAAGCATTGAAGAAGAGCATCTAGCACGAGTTCGCAAGGATTTAATAGACGAACGACGTATTCGTGAAGAAGACATCTA
TCATAGAGTTTCTCATTTGTTGTTGGATAAGGTGGCAACAGGCGGTCCTGGAAGCTTAAAGCCAGGATCTAAAATCACCC
AGGATTACTTAGATAAGGTTGAAAGAGAAAAGTGGTTTGATATTCGTATAGAAGATGACGCAGTTAGTCAGCAACTTGAA
CAATTATCCAAGCAGCTGGAACTTTTAACAAAAGAAATGGAAAAGCGCTTTAACGACAGTAGAAAGAAAATTATCCAGGG
AGATGATTTAGCTCCTGGTGTATTAAAAATTGTTAAAGTGTATTTGGCTGTTAAAAGAAGAATTCAGCCTGGAGACAAAA
TGGCAGGTCGTCATGGAAACAAGGGTGTGATCTCCATTGTTGTTCCAGTTGAAGATATGCCACATATGGAAGATGGAACG
GCTGTAGATATCGTTCTTAATCCATTGGGCGTACCATCGCGAATGAATATCGGTCAGGTTCTTGAAACGCATTTAGGACT
AGCTGCCAAAGGATTAGGAAGAAAGATTGCACAGATGCTTGATGAAAGGCAAACACCTGAAGCAATAAAAGCATACCTTG
AGAAAATTTATAATCATGACGGAGTGCAGCGTGTTAATTTGAAATGCCTCAATGATGATGAATTGATGACACTGGCTGAT
AACCTGAGAGCTGGTGTGCCGATGGCAACTCCCGTCTTTGATGGTGCTACTGAGCAAGAAATCAAAAGTATGTTGCAGTT
AGCAGATTTACCAGCAGATGGTAAAACTGTGTTGATAGATGGCCGAACAGGTAATAAATTTGATAATCCGGTTACTGTAG
GCTACATGTATATGTTGAAGTTAAACCATTTGGTTGATGATAAGATGCATGCTCGCTCAACTGGATCATACAGTTTGGTC
ACTCAACAACCACTTGGCGGTAAAGCACAGTTTGGTGGTCAGCGTTTTGGTGAGATGGAAGTATGGGCATTAGAAGCATA
TGGTGCAGCATACACTTTACAAGAAATGTTAACCGTAAAATCAGATGACGTCGGAGGTCGAACAAAGATCTATAAAAATA
TAGTCGATGGAGATCATCGTATGGACCCAGGAATGCCTGAATCCTTCAATGTATTATTGAAGGAAATTAGAGCACTGGGA
ATTGATATCGAGTTGGAGCATGACTAA