MEGAResFrom MEG, the Microbial Ecology Group

RBPA

Resistance to rifampin can be mediated through increased transcription of gene targets that are otherwise inhibitted by rifampin. This increased transcriptional activity is mediated by the rbpA gene, which confers basal resistance to rifampin and is a regulator of rRNA synthesis.

References

Sequences

Download Sequences

>CARD|phgb|HQ203032|0-345|ARO:3000245|RbpA|Rifampin|RNA-polymerase_binding_protein|RBPA
ATGGCTGATCGTGTCCTGCGGGGCAGTCGCCTCGGAGCCGTGAGCTACGAGACCGACCGCAACCATGACCTGGCGCCGCG
TCAGGTCGCCCGCTACCGCACGGATAACGGCGAGGAGTTCGACGTACCTTTCGCCGACGACGCCGAGATCCCCGGTACGT
GGCTCTGCCGCAACGGTCTGGAGGGCACCCTCATCGAGGGTGACGTGCCGGAGCCCAAGAAGGTCAAGCCGCCGCGTACG
CACTGGGACATGCTGTTGGAGCGCCGGTCCGTCGAGGAGCTCGAAGAGCTGCTCAAGGAGCGTCTCGACCTGATCAAGGC
CAAGCGGCGCGGAACCGGAAGCTGA