MEGAResFrom MEG, the Microbial Ecology Group

PEXA

The pexA gene encodes a chloramphenicol efflux pump.

References

  • http://onlinelibrary.wiley.com/doi/10.1016/j.femsre.2004.04.001/pdf

Other Groups in Phenicol resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_5773|Drugs|Phenicol|Phenicol_resistance_MFS_efflux_pumps|PEXA
ATGAAAAAGTTTGTACTTTTTTGCGAGCGTAATGGAATCGCTTTGATTCCGATCGTTTTGATCCTTTTGGGTTGTGGTCT
TTGGCCAGAGATGGAACTTTTGGTTCCGAGTTTGCCTGACATGCAGCGTGCCTTTAACATCCAAGATGCGCAGATTCAAC
AGTTGCTGACTGCAAATTTTGTCGGATTTCTTATCGGTGTTCTCTTTGCGGGTCCCCTTTGTGACAGTGCAGGTCGAAGA
ACCGTAATGATGATAGGGACGATAGGTTACCTTGTTTCGTCCGTGCTTTGTCCGTTTTGTAACGACTTTGTGCTTTTAAT
GATTGCCCGATTTTTCCAAGGCTTGTTCATGACGGGGCCGGTCATTGCCGGTGGTGTCCTCTTGATGGAAGCCACGGAAG
GGGTGAAACAAATCTTTTGGATGTCGATTGGTAATGCAGCTATTACGTTTTGCATGGCTGCAGGACCTATTGTTGGATCT
TGGATCAATACAGGTTTTGGCTATGTTGGAAATCTGTGGAGCATTCTCATCCTTGGTTTGATTGGCTGCCTTCCTGCGTT
ATTTTTAGTGCCGGAAAGTCTTCCAGTTGAGAAGCGAGCAGCTTTCCATCCCAAACTACTTTTCAAAGGGTATTTTGCGC
TATTGAAAGATTTTAGGTTTATGTGTCTTGCGATTCCCATGTGCGCACTAGCGGCAGCCTATTGGATCTACGTCGGTGTA
AGTGCCTTATACATGGTGAATCAGTTGGGAATTGCGCAAGAGATGTTCGGTCGTTATCAAGGACCTATCGTTGGTTGCTT
CTCGATAATCTCTCTTGGCTCTTCGAAACTTCTTCAGCGCTTTGGTTTGATGAAATGCCTACGTGCAGGAATTGTTTCCA
TGTTCACGGGTATGCTTCTTCTTTTAGGCATGAGCATTCTTTCTTTGGATCATGCAGTAGCGACAACGGTGTTTATGATG
TTCTTCGTTGGAGGAATGGCACCGATTTGCAGCATGCTTTTCCCATATGCTTTGGGACATTTGCCTGTCGATCTAAAAGG
GAATGCACAAGCCATGGTACAAGCGATTAGACTCTTTTTCGCATCAATTGGTACTTCCTTGGTTGGTGTCTTCTACAAAA
GTGCTTTTTTGCCAGTAGCCCTGATTATGTTCGCCATTCTTCTCTTCAGTTGCTACTTCCTTTGGAAGGGAAGACGTTAC
TTGAAAGAAGGTCTTGGTGCGGATCATATTTTGAGCGTTGGTCACTAG