MEGAResFrom MEG, the Microbial Ecology Group

CMRA

The cmrA gene encodes a chloramphenicol exporter.

References

  • http://onlinelibrary.wiley.com/doi/10.1016/j.femsre.2004.04.001/pdf

Other Groups in Phenicol resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_1780|Drugs|Phenicol|Phenicol_resistance_MFS_efflux_pumps|CMRA
GTGCCTTTCGCTATCTACGTCCTCGGGCTTGCCGTCTTTGCCCAGGGCACATCCGAATTCATGTTGTCCGGGCTCATACC
GGATATGGCCCGCGACCTCGGCGTCTCGGTCCCCGCCGCCGGACTCCTCACCTCCGCCTTCGCGGTCGGGATGATCATCG
GCGCTCCGCTGATGGCCATCGCCAGCATGCGGTGGCCCCGGCGACGCGCCCTTTTGACATTCCTCATCACGTTCATGCTG
GTCCACGTCATCGGCGCGCTCACCAGCAGCTTCGAGGTCTTGCTGGTCACACGCATCGTCGGCGCCCTCGCCAACGCCGG
ATTCTTGGCGGTGGCCCTGGGCGCGGCGATGGCGATGGTGCCCGCCGACATGAAAGGGCGCGCAACGTCCGTCCTCCTCG
GTGGTGTCACGATCGCATGTGTAGCCGGAGTTCCCGGGGGCGCCTTCCTCGGTGAAATATGGGGCTGGCGTGCAGCGTTC
TGGGCTGTCGTCGTCATCTCCGCCCCTGCGGTGGTGGCGATCATGTTCGCCACCCCGGCCGAGCCGCCAGCAGAGTCCAC
ACCGAACGCCAAGCGTGAACTGTCCTCGCTGCGCTCACGCAAGCTCCAGCTGATGCTTGTCCTCGGTGCCCTGATCAACG
GCGCAACATTCTGTTCGTTCACCTACATGGCGCCCACTCTCACCGACATCTCCGGTTTCGACTCCCGTTGGATTCCGTTG
CTGCTGGGGTTGTTCGGGCTCGGATCGTTCATCGGCGTCAGCGTCGGAGGCAGGCTCGCCGATACCCGGCCGTTCCAACT
TCTCGCCGTGGGATCCGCAGCACTGTTGACGGGATGGATCGTCTTCGCTCTCACGGCATCCCACCCTGCGGTGACATTGG
TGATGCTGTTCGTGCAGGGCGCTCTGTCCTTCGCGGTCGGCTCGACCTTGATCTCCCAGGTGCTCTACGCCGCCGACGCG
GCGCCGACCTTGGGTGGATCGTTCGCGACGGCCGCGTTCAACGTCGGCGCTGCACTGGGCCCGGCCCTCGGCGGGCTGGC
GATCGGTATGGGCCTGAGCTACCGCGCCCCGCTCTGGACGAGCGCCGCGCTGGTGACTCTCGCGATCGTCATCGGCGCAG
CCACCTTGTCGCTCTGGCGGCGTCCAGCGTCCGTCCAGGAAACCGTCCCAGCCTGA

>>MEG_1781|Drugs|Phenicol|Phenicol_resistance_MFS_efflux_pumps|CMRA
GTGCCATTCGCCATCTATGTCCTGGGTATTGCTGTATTCGCCCAGGGCACATCGGAATTCATGCTGTCCGGACTCATACC
GGATATGGCTCAGGATCTACAGGTTTCGGTCCCCACTGCAGGACTTCTCACTTCGGCATTCGCAATCGGCATGATCATCG
GTGCCCCGTTGATGGCAATTGTCAGTATGCGGTGGCAACGTCGACGAGCGCTCTTGACCTTCCTCATCACTTTTATGGTT
GTGCATGTCATCGGCGCACTCACCGACAGTTTCGGCGTCTTGCTGGTCACCCGGATCGTAGGAGCACTGGCCAACGCCGG
TTTCCTGGCTGTAGCGCTGGGCGCAGCCATGTCGATGGTTCCTGCCGACATGAAGGGACGAGCGACCTCAGTTCTACTGG
GCGGAGTGACCATCGCCTGCGTAGTTGGAGTCCCGGGCGGAGCGCTATTGGGCGAACTGTGGGGATGGCGCGCCTCGTTC
TGGGAGGTAGTGCTGATTTCCGCACCGGCAGTGGCAGCGATCATGGCATCGACCCCTGCTGATTCCCCTACAGATTCTGT
TCCGAACGCGACCCGCGAACTGTCCTCGCTGCGTCAACGCAAACTTCAACTGATCTTGGTGCTGGGCGCGCTGATCAACG
GTGCCACCTTCTGTTCCTTCACCTACCTGGCTCCGACGCTCACCGACGTCGCCGGGTTCGACTCTCGCTGGATCCCTTTG
CTTCTCGGACTGTTCGGACTGGGGTCGTTCATCGGCGTCAGTGTCGGTGGCCGGCTCGCTGACACCCGTCCGTTTCAATT
GCTGGTGGCGGGCTCGGCAGCTCTTCTGGTCGGGTGGATCGTGTTCGCTATCACTGCCTCTCACCCGGTAGTGACCCTGG
TGATGCTGTTCGTGCAAGGAACGCTGTCGTTCGCTGTGGGGTCGACGTTGATCTCGCGAGTGCTCTACGTCGCCGACGGT
GCTCCGACTTTGGGGGGATCCTTCGCTACGGCTGCCTTCAATGTCGGAGCCGCATTGGGGCCGGCCCTCGGCGGTGTGGC
CATCGGTATCGGAATGGGCTATCGCGCTCCACTGTGGACCAGCGCGGCTCTGGTGGCACTTGCGATCGTGATCGGTGCCG
CGACGTGGACGCGTTGGCGGGAACCACGTCCAGCGCTGGACACCGTTCCTCCGTGA