MEGAResFrom MEG, the Microbial Ecology Group

FEXA

The fexA gene encodes a chloramphenicol efflux pump.

References

Other Groups in Phenicol efflux pumps

Sequences

Download Sequences

>Phe|AJ549214.1|gene2|Phenicol|Phenicol_efflux_pumps|FEXA
AGGAGGAAATAAAATGAAAAAGGATAGTAAATCTAAAGAAATGATTCAATCTGAAAAAAGGGGTTCTACTAGGCTTTTAA
TGATGGTACTCTCCCTATCTGTACTTGTAGGTGCAATTACGGCTGATTTAGTCAATCCCGTACTTCCACTAATAAGCAAA
GATTTAGAAGCTTCGAAATCTCAAGTGAGTTGGATAGTTAGTGGTATTGCACTTGTTCTTGCGATTGGAGTTCCGATTTA
TGGTCGAATCTCAGACTTTTTTGAGTTACGAAAGCTATATATCTTTGCCATTATGATTCTGGCAAGTGGTAGTCTTTTAT
GTGCAATTGCCCCGAACCTCCCATTGTTGGTTTTGGGAAGAATGGTTCAGGGTGCTGGGATGTCCGCAATTCCAGTTCTA
TCAATCATTGCAATTTCGAAGGTTTTCCCACAAGGAAAACGTGGGGGAGCTTTGGGAATTATCGCAGGAAGTATTGGTGT
TGGAACTGCTGCTGGTCCAATATTTGGTGGAGTAGTTGGTCAATATTTAGGGTGGAATGCCTTGTTTTGGTTCACATTTT
TGTTAGCCATTATGATTGTTATTGGTGCCTACTACGCGTTACCGACAATTAAACCGGCAGAATCCGTAGGAAGCAATAAG
AACTTTGATTTCATTGGTGGTTTATTCCTCGGCCTCACAGTAGGATTACTCCTTTTTGGCATCACTCAAGGAGAAACTTC
TGGTTTTTCTTCGTTCTCATCGTTAACTAGCCTAATTGGTTCTGTTGTAGCTTTGGTGGGATTTATTTGGAGAATTGTTA
CCGCAGAAAATCCATTTGTACCACCTGTCCTGTTCAATAACAAGGATTATGTCAATACGGTCATAATTGCATTTTTTTCG
ATGTTTGCTTATTTCGCTGTTCTTGTGTTCGTCCCATTACTAGTCGTTGAGGTGAATGGACTCTCTTCTGGACAGGCTGG
AATGATATTGTTGCCAGGTGGTGTGGCTGTTGCAATCTTATCTCCCTTCGTTGGCCGTCTTTCTGATCGATTTGGGGATA
AACGTCTGATAATTACTGGGATGACTCTGATGGGGCTGTCTACCTTATTCTTGTCCACCTATGCATCTGGTGCTTCACCT
CTGTTAGTTTCCGTGGGGGTCCTCGGAGTAGGGATTGCTTTTGCATTCACGAATTCTCCCGCAAATAACGCCGCAGTAAG
TGCACTCGATGCAGACAAGGTTGGTGTCGGAATGGGGATTTTCCAAGGTGCTTTGTACCTTGGAGCAGGAACTGGAGCAG
GTATGATTGGAGCATTATTATCCGCTCGACGTGATGCTACTGAGCCGATAAATCCATTATATATATTGGACGCTATGTCC
TACTCAGATGCGTTCCTTGCAGCTACAGGGGCAATACTCATTGCCTTAATAGCTGGATTAGGTTTAAAAAAGCGTGGGTA
A

>Phe|fexA_1_AJ549214|Phenicol|Phenicol_efflux_pumps|FEXA
ATGAAAAAGGATAGTAAATCTAAAGAAATGATTCAATCTGAAAAAAGGGGTTCTACTAGGCTTTTAATGATGGTACTCTC
CCTATCTGTACTTGTAGGTGCAATTACGGCTGATTTAGTCAATCCCGTACTTCCACTAATAAGCAAAGATTTAGAAGCTT
CGAAATCTCAAGTGAGTTGGATAGTTAGTGGTATTGCACTTGTTCTTGCGATTGGAGTTCCGATTTATGGTCGAATCTCA
GACTTTTTTGAGTTACGAAAGCTATATATCTTTGCCATTATGATTCTGGCAAGTGGTAGTCTTTTATGTGCAATTGCCCC
GAACCTCCCATTGTTGGTTTTGGGAAGAATGGTTCAGGGTGCTGGGATGTCCGCAATTCCAGTTCTATCAATCATTGCAA
TTTCGAAGGTTTTCCCACAAGGAAAACGTGGGGGAGCTTTGGGAATTATCGCAGGAAGTATTGGTGTTGGAACTGCTGCT
GGTCCAATATTTGGTGGAGTAGTTGGTCAATATTTAGGGTGGAATGCCTTGTTTTGGTTCACATTTTTGTTAGCCATTAT
GATTGTTATTGGTGCCTACTACGCGTTACCGACAATTAAACCGGCAGAATCCGTAGGAAGCAATAAGAACTTTGATTTCA
TTGGTGGTTTATTCCTCGGCCTCACAGTAGGATTACTCCTTTTTGGCATCACTCAAGGAGAAACTTCTGGTTTTTCTTCG
TTCTCATCGTTAACTAGCCTAATTGGTTCTGTTGTAGCTTTGGTGGGATTTATTTGGAGAATTGTTACCGCAGAAAATCC
ATTTGTACCACCTGTCCTGTTCAATAACAAGGATTATGTCAATACGGTCATAATTGCATTTTTTTCGATGTTTGCTTATT
TCGCTGTTCTTGTGTTCGTCCCATTACTAGTCGTTGAGGTGAATGGACTCTCTTCTGGACAGGCTGGAATGATATTGTTG
CCAGGTGGTGTGGCTGTTGCAATCTTATCTCCCTTCGTTGGCCGTCTTTCTGATCGATTTGGGGATAAACGTCTGATAAT
TACTGGGATGACTCTGATGGGGCTGTCTACCTTATTCTTGTCCACCTATGCATCTGGTGCTTCACCTCTGTTAGTTTCCG
TGGGGGTCCTCGGAGTAGGGATTGCTTTTGCATTCACGAATTCTCCCGCAAATAACGCCGCAGTAAGTGCACTCGATGCA
GACAAGGTTGGTGTCGGAATGGGGATTTTCCAAGGTGCTTTGTACCTTGGAGCAGGAACTGGAGCAGGTATGATTGGAGC
ATTATTATCCGCTCGACGTGATGCTACTGAGCCGATAAATCCATTATATATATTGGACGCTATGTCCTACTCAGATGCGT
TCCTTGCAGCTACAGGGGCAATACTCATTGCCTTAATAGCTGGATTAGGTTTAAAAAAGCGTGGGTAA

>Phe|FexA|JQ041372|14024-15451|1428|Phenicol|Phenicol_efflux_pumps|FEXA
ATGAAAAAGGATAGTAAATCTAAAGAAATGATTCAATCTGAAAAAAGGGGTTCTACTAGGCTTTTAATGATGGTACTCTC
CCTATCTGTACTTGTAGGTGCAATTACGGCTGATTTAGTCAATCCCGTACTTCCACTAATAAGCAAAGATTTAGAAGCTT
CGAAATCTCAAGTGAGTTGGATAGTTAGTGGTATTGCACTTGTTCTTGCGATTGGAGTTCCGATTTATGGTCGAATCTCA
GACTTTTTTGAGTTACGAAAGCTATATATCTTTGCCATTATGATTCTGGCAAGTGGTAGTCTTTTATGTGCAATTGCCCC
GAACCTCCCATTGTTGGTTTTGGGAAGAATGGTTCAGGGTGCTGGGATGTCCGCAATTCCAGTTCTATCAGTCATTGCAA
TTTCGAAGGTTTTCCCACAAGGAAAACGTGGGGGAGCTTTGGGAATTATCGCAGGAAGTATTGGTGTTGGAACTGCTGCT
GGTCCAATATTTGGTGGAGTAGTTGGTCAATATTTAGGGTGGAATGCCTTGTTTTGGTTCACATTTTTGTTAGCCATTAT
GATTGTTATTGGTGCCTACTACGCGTTACCGACAATTAAACCGGCAGAATCCGTAGGAAGCAATAAGAACTTTGATTTCA
TTGGTGGTTTATTCCTCGGCCTCACAGTAGGATTACTCCTTTTTGGCATCACTCAAGGAGAAACTTCTGGTTTTTCTTCG
TTCTCATCGTTAACTAGCCTAATTGGTTCTGTTGTAGCTTTGGTGGGATTTATTTGGAGAATTGTTACCGCAGAAAATCC
ATTTGTACCACCTGTCCTGTTCAATAACAAGGATTATGTCAATACGGTCATAATTGCATTTTTTTCGATGTTTGCTTATT
TCGCTGTTCTTGTGTTCGTCCCATTACTAGTCGTTGAGGTGAATGGACTCTCTTCTGGACAGGCTGGAATGATATTGTTG
CCAGGTGGTGTGGCTGTTGCAATCTTATCTCCCTTCGTTGGCCGTCTTTCTGATCGATTTGGGGATAAACGTCTGATAAT
TACTGGGATGACTCTGATGGGGCTGTCTACCTTATTCTTGTCCACCTATGCATCTGGTGCTTCACCTCTGTTAGTTTCCG
TGGGGGTCCTCGGAGTAGGGATTGCTTTTGCATTCACGAATTCTCCCGCAAATAACGCCGCAGTAAGTGCACTCGATGCA
GACAAGGTTGGTGTCGGAATGGGGATTTTCCAAGGTGCTTTGTACCTTGGAGCAGGAACTGGAGCAGGTATGATTGGAGC
ATTATTATCCGCTCGACGTGATGCTACTGAGCCGATAAATCCATTATATATATTGGACGCTATGTCCTACTCAGATGCGT
TCCTTGCAGCTACAGGGGCAATACTCATTGCCTTAATAGCTGGATTAGGTTTAAAAAAGCGTGGGTAA