MEGAResFrom MEG, the Microbial Ecology Group

CMRA

The cmrA gene encodes a chloramphenicol exporter.

References

Other Groups in Phenicol efflux pumps

Sequences

Download Sequences

>267|Z12001.1|Z12001|Phenicol|Phenicol_efflux_pumps|CMRA
GTGCCATTCGCCATCTATGTCCTGGGTATTGCTGTATTCGCCCAGGGCACATCGGAATTCATGCTGTCCGGACTCATACC
GGATATGGCTCAGGATCTACAGGTTTCGGTCCCCACTGCAGGACTTCTCACTTCGGCATTCGCAATCGGCATGATCATCG
GTGCCCCGTTGATGGCAATTGTCAGTATGCGGTGGCAACGTCGACGAGCGCTCTTGACCTTCCTCATCACTTTTATGGTT
GTGCATGTCATCGGCGCACTCACCGACAGTTTCGGCGTCTTGCTGGTCACCCGGATCGTAGGAGCACTGGCCAACGCCGG
TTTCCTGGCTGTAGCGCTGGGCGCAGCCATGTCGATGGTTCCTGCCGACATGAAGGGACGAGCGACCTCAGTTCTACTGG
GCGGAGTGACCATCGCCTGCGTAGTTGGAGTCCCGGGCGGAGCGCTATTGGGCGAACTGTGGGGATGGCGCGCCTCGTTC
TGGGAGGTAGTGCTGATTTCCGCACCGGCAGTGGCAGCGATCATGGCATCGACCCCTGCTGATTCCCCTACAGATTCTGT
TCCGAACGCGACCCGCGAACTGTCCTCGCTGCGTCAACGCAAACTTCAACTGATCTTGGTGCTGGGCGCGCTGATCAACG
GTGCCACCTTCTGTTCCTTCACCTACCTGGCTCCGACGCTCACCGACGTCGCCGGGTTCGACTCTCGCTGGATCCCTTTG
CTTCTCGGACTGTTCGGACTGGGGTCGTTCATCGGCGTCAGTGTCGGTGGCCGGCTCGCTGACACCCGTCCGTTTCAATT
GCTGGTGGCGGGCTCGGCAGCTCTTCTGGTCGGGTGGATCGTGTTCGCTATCACTGCCTCTCACCCGGTAGTGACCCTGG
TGATGCTGTTCGTGCAAGGAACGCTGTCGTTCGCTGTGGGGTCGACGTTGATCTCGCGAGTGCTCTACGTCGCCGACGGT
GCTCCGACTTTGGGGGGATCCTTCGCTACGGCTGCCTTCAATGTCGGAGCCGCATTGGGGCCGGCCCTCGGCGGTGTGGC
CATCGGTATCGGAATGGGCTATCGCGCTCCACTGTGGACCAGCGCGGCTCTGGTGGCACTTGCGATCGTGATCGGTGCCG
CGACGTGGACGCGTTGGCGGGAACCACGTCCAGCGCTGGACACCGTTCCTCCGTGA

>CARD|phgb|AF015087|435-1611|ARO:3002702|cmrA|Phenicol|Phenicol_efflux_pumps|CMRA
GTGCCTTTCGCTATCTACGTCCTCGGGCTTGCCGTCTTTGCCCAGGGCACATCCGAATTCATGTTGTCCGGGCTCATACC
GGATATGGCCCGCGACCTCGGCGTCTCGGTCCCCGCCGCCGGACTCCTCACCTCCGCCTTCGCGGTCGGGATGATCATCG
GCGCTCCGCTGATGGCCATCGCCAGCATGCGGTGGCCCCGGCGACGCGCCCTTTTGACATTCCTCATCACGTTCATGCTG
GTCCACGTCATCGGCGCGCTCACCAGCAGCTTCGAGGTCTTGCTGGTCACACGCATCGTCGGCGCCCTCGCCAACGCCGG
ATTCTTGGCGGTGGCCCTGGGCGCGGCGATGGCGATGGTGCCCGCCGACATGAAAGGGCGCGCAACGTCCGTCCTCCTCG
GTGGTGTCACGATCGCATGTGTAGCCGGAGTTCCCGGGGGCGCCTTCCTCGGTGAAATATGGGGCTGGCGTGCAGCGTTC
TGGGCTGTCGTCGTCATCTCCGCCCCTGCGGTGGTGGCGATCATGTTCGCCACCCCGGCCGAGCCGCCAGCAGAGTCCAC
ACCGAACGCCAAGCGTGAACTGTCCTCGCTGCGCTCACGCAAGCTCCAGCTGATGCTTGTCCTCGGTGCCCTGATCAACG
GCGCAACATTCTGTTCGTTCACCTACATGGCGCCCACTCTCACCGACATCTCCGGTTTCGACTCCCGTTGGATTCCGTTG
CTGCTGGGGTTGTTCGGGCTCGGATCGTTCATCGGCGTCAGCGTCGGAGGCAGGCTCGCCGATACCCGGCCGTTCCAACT
TCTCGCCGTGGGATCCGCAGCACTGTTGACGGGATGGATCGTCTTCGCTCTCACGGCATCCCACCCTGCGGTGACATTGG
TGATGCTGTTCGTGCAGGGCGCTCTGTCCTTCGCGGTCGGCTCGACCTTGATCTCCCAGGTGCTCTACGCCGCCGACGCG
GCGCCGACCTTGGGTGGATCGTTCGCGACGGCCGCGTTCAACGTCGGCGCTGCACTGGGCCCGGCCCTCGGCGGGCTGGC
GATCGGTATGGGCCTGAGCTACCGCGCCCCGCTCTGGACGAGCGCCGCGCTGGTGACTCTCGCGATCGTCATCGGCGCAG
CCACCTTGTCGCTCTGGCGGCGTCCAGCGTCCGTCCAGGAAACCGTCCCAGCCTGAC