MEGAResFrom MEG, the Microbial Ecology Group

ARAJ

The araJ gene encodes a putative efflux transporter that acts on chloramphenicol.

References

Other Groups in Phenicol efflux pumps

Sequences

Download Sequences

>195|U09991.1|SVU09991|Phenicol|Phenicol_efflux_pumps|ARAJ
ATGCCGTCTCCCTCCGCCGAGCCCACGACATCCACCCCGACCCCCGACGCCGGGCCCGCCGCATCCCCCCGGATGCCCCT
GGCCGTCTACATCCTCGGACTGTCCGCGTTCGCGCTCGGGACGAGCGAATTCATGCTCTCCGGCCTCGTGCCGCCCATCG
CGGAGGACATGAACGTCTCCATCCCCCGCGCCGGACTCCTCATCTCGGCGTTCGCGATCGGCATGGTCGTCGGCGCACCG
CTCCTCGCCGTCGCCACCCTCCGGCTCCCCCGCAAGACCACCCTCATCGCCCTCATCACCGTCTTCGGCCTGCGCCAGAT
GGCCGGCGCCCTCGCCCCCAACTACGCGGTCCTCTTCGCCTCCCGCGTGATCAGCGCCCTGCCCTGCGCGGGCTTCTGGG
CGGTCGGCGCGGCGGTGGCCATCGCGATGGTCCCGGTCGGCTCACGGGCCCGGGCGCTGGCGGTCATGATCGGCGGCCTC
TCCATCGCCAACGTCCTGCGCGTCCCCGCCGGCGCCTTCCTCGGCGAGCACCTCGGCTGGGCCTCCGCCTTCTGGGCCGT
CGGCCTCGCCTCCGCCATCGCGCTCGTCGGCGTCGTCACCCGCATCCCCCGCATCCCGCTCCCCGAGACCAGGCCCCGCC
CTCTCAAGAACGAGGTCGCCATCTACCGCGACCGCCAGGTCCTCCTGTCGATCGCGGTCACGGCCCTCGCGGCGGGCGGC
GTCTTCTGCGCCTTCTCGTACCTCGCGCCGCTGCTCACCGACGTCTCCGGCCTCGACGAGGCCTGGGTCTCCGGCGTCCT
CGGCCTCTTCGGCATCGGCGCCGTCGTCGGTACGACGATCGGCGGCCGGGTCGCCGACGCGCACCTCTTCGGCGTGCTGC
TCACCGGCATCTCCGCCTCCACCGTCTTCCTCGTGGCCCTGGCCCTGTTCGCCTCGAACCCGGCCGCCACGATCGTGCTG
ACCTTCCTCCTCGGCGTCTCGGCCTTCTACACGGCCCCGGCCCTCAACGCCCGCATGTTCAACGTCGCCGGCGCCGCCCC
CACCCTCGCGGGCGCCACCACCACCGCCGCCTTCAACCTCGGCAACACGGGCGGCCCCTGGCTCGGCGGCACGGTCATCG
ACGCGAACCTCGGCTTCGCCTCGACGGCCTGGGCGGGCGCGGCGATGACGGTCCTGGGCCTGGGAACGGCGGCCCTGGCC
CTCCGCCTGACCAAGCGCCCGGCCCCCGGCCACGTGGTCGCCCGGAGCAGAGGGGCGGGCGGGACCACCCCGTCCGAACC
GGCCAGGGGGAAGGCCACGTCGAGCTGCTGA