MEGAResFrom MEG, the Microbial Ecology Group

CLBC

The clb genes encode a cfr-like protein that confers resistance to phenicols via the methylation of the 23S ribosomal RNA.

References

Other Groups in Phenicol 23S rRNA methyltransferases

Sequences

Download Sequences

>CARD|phgb|NC_006582|1162417-1163470|ARO:3002816|clbC|Phenicol|Phenicol_23S_rRNA_methyltransferases|CLBC
ATGAAAGTTGTCAATCATGCGACAAAATACGAACGATTAAAACATTTTTTGAATGCTTTAAATGAACCAACGTACCGGTA
TAAACAGATTACTGAAGCGATTTTCAAACATCGTATTGGTGCGTTTAATAAAATGACCACATTGCCAAAAGCACTGAGAG
AATCGCTCATAAACGAATTTGGTCCTTCCATCCTTACAGTAGAGCCGGTGCTAGAAACAACGTCTCAACAAGTCACTAAA
GTGTTGCTAAAAGTAGCGGGAAACAATCAAGTGGAAGCCGTAAGAATGCATTATGAAGCAGGGTGGGAGTCGTTTTGCAT
TTCTTCTCAATGTGGCTGTGGGTTAGGGTGTACGTTTTGTTCGACAGGAGCCATTGGGTTAAAACAAAACTTATCAGCAG
ACGAGATGACAGACCAGTTGCTCTATTTTTATCTGAAGGGGCATTCCTTAGATAGTGTCTCTTTTATGGGCATGGGCGAA
GCGCTAGCCAATGTAAGGATATTTGATGCTTTGAATGTGCTTGTCGATCGGCAACTATTTGCATTAAGTCCTAGAAGAAT
AACGGTCTCTACGGTTGGCATCATACCAAACATCCAAAGAATGACTAGCAGCTTTCCTCAGATGAACCTAACGTTTTCAC
TGCACTCTCCTTTTCATGATCAGCGCAGCGAGTTGATGCCGATTAACAACAAGTACCCGTTAGACCAGGTAATGAATGTA
TTGGATCAGCATATTCACGAGACAGGGAGAAAAGTATATATTGCTTATGTCATGCTTCGGGGTGTCAATGATTCGGAGAA
ACATGCAGAAGCACTTGTTAAACGGATTCTAAACAATCGCTATCCCCATCTCTATCATGTCAATTTGATTCGCTACAATC
CGACTGTGGGTACGCCTGAAAACTATGGCCAAACCATAGAAGAGAAACTGCAAACTTTTTACCGTGTCGTAAAATCAGCT
CGAATTCCTGTAACGATTCGGAGTCAATTTGGAAGAGAAATTGATGCCGCCTGCGGCCAATTATATGGTCAGTATCAGGC
GAAAAAAAGGTGAA