MEGAResFrom MEG, the Microbial Ecology Group

CLBB

The clb genes encode a cfr-like protein that confers resistance to phenicols via the methylation of the 23S ribosomal RNA.

References

Other Groups in Phenicol 23S rRNA methyltransferases

Sequences

Download Sequences

>CARD|phgb|NC_012491|4758175-4759207|ARO:3002815|clbB|Phenicol|Phenicol_23S_rRNA_methyltransferases|CLBB
TTATTCAGAGCGGTATAACTGGCCGCATGCCGCGTTTATGTCCGATCCGAATTGAGTTCGGACCGTGACGCTTATCCCCC
TTGACTTCAAGATCCGAACAAACGCTTTAATCCGCGAAGGATCGGATTGCCGATAGCTGTCTGGCGTAACTTCGGTCGAA
TTGAATGGAATCAGGTTAACGTGGTAGAGATGTTCCCAAGCTCCCCTTCCCCTTAGCAACTCGGCAACTGCTTCCGCATG
CGCTGTCGAGTCGTTTACTCCACGAAGAAGAATATACGCAATATATACCTTTCTCCCTGTTTCCCTGATGTGACGATCCA
ATGCTATCAGTACGTCACGGACTGGAAATCGGTCGTTGATCGGCATCAGCTCGCTTCGCTGATCGTCGAACGGTGAATGC
AGCGAGAAGGTTAGATTGACCTGGGGGAACTCCCGAGTCAGCTTGTCAATCCCCGGCAACAGGCCGATCGTGGAAATCGT
AATTCGTCGATGTCCTAAACCGAAGAGATACGGGTCGGTCAATATCGTCATGGCCTCAAAAATATGCGGGTTGGCGAGCG
CCTCTCCCATGCCCATGAATGAGATGCTGTCCAAAGAGTGGCCGTTCAAACGAAAGTACAGCAATTGGTCGGTAATTTCG
TCGGCGGTCAGATTTCGTTTCAGACCAATGGTACCGGTAGCACAAAACTTGCACCTGAATCCGCAGCCGCACTGTGTGGA
AATACAATACGATTTCCACCCCCGTTCATAAGTAAGTCGTACGGCCTCGACCTGTTCGTCGCCCGGAATCGCAAACAGCA
CCTTGCTAACCTGTTTCGACGTGAGCTCCTTTACCGGAGCGATACTGCAAACGTTCGGTCCAAGTATCCGATTCAACTCG
TCGCGCAAAAATTTGGGTAGGATGGTCATCCGTTCGTATTCGCCGATGTTTTGCTTGAAAATGGCGTCCATAATCTGAGC
ATACCGATACTCAGGCTGCTTGCATTCGGACAAGATTCGCCGAATCGTTTCATATTTCGAGGTTAGTTTCATG