MEGAResFrom MEG, the Microbial Ecology Group

CLBA

The clb genes encode a cfr-like protein that confers resistance to phenicols via the methylation of the 23S ribosomal RNA.

References

Other Groups in Phenicol 23S rRNA methyltransferases

Sequences

Download Sequences

>CARD|phgb|NC_009725|543798-544848|ARO:3002814|clbA|Phenicol|Phenicol_23S_rRNA_methyltransferases|CLBA
ATGCAACAAAAAAACAAGTATATAAGAATCCAAGAGTTCCTGAAGCAAAATAAATTTCCTGATTTTAGAATGAATCAAAT
CAAAAATGCTGTATTCCAAGGGAGAATAAATCATTTCAATGAAATAACGGTTCTTCCTAAATCCCTGAGAAAATTGTTAA
TAGAGGAGTTCGGAGAGTCGATTTTAAATATTGCTCCTTTAAAAGTGCAGCATTCTGAGCAAGTAACAAAAGTCTTATTT
GAAATTTCCGGAGACGAAAAAATAGAAACGGTTAATATGAAATATAAAGCCGGTTGGGAGTCATTTTGTATATCCTCGCA
GTGCGGCTGTCATTTCGGCTGTAAATTTTGTGCAACAGGAGATATTGGTTTAAAACGCAATTTAACGTCAGATGAAATGA
CTGACCAAATTTTGTACTTTCACTTAAAAGGACATTCAATTGACAGTATTTCTTTTATGGGAATGGGAGAAGCATTAGCG
AATGTACAAGTTTTTGATGCTTTACATGTGCTTACAAATCCGGAGTTGTTTGCTTTAAGCCCTCGCAGGTTATCTATTTC
GACTATAGGTATTATTCCGGGCATTAAAAAAATCACTCAGGATTATCCGCAGGTCAACCTGACGTTTTCATTACATTCTC
CTTTTAATGAACAGCGAAGCAAGTTAATGCCGATTAATGAACGCTACCCGTTATTGGAGGTAATGGACACATTAGATGAG
CATATACGTGTGACCTCAAGAAAAGTTTATATTGCTTATATTATGCTGCCGGGAGTTAATGATTCTATTGATCATGCGAA
TGAAGTAGTAAATCTTTTAAGAAGCAGATATAAGAGAGGGAACTTGTTCCATGTAAACATCATTAGATATAACCCGACTG
TTAGTTCACCTATGAGATTTGAAGAAGTAAATGAGAAACAAGTTGTAAACTTCTATAAAAAATTAAAGTCAGCAGGAATT
AACGTGACCGTCAGAAGTCAATTTGGTATTGATATAGATGCTGCTTGCGGACAATTATATGGAAATTATCAAAAAAATAA
GAACCAATAAA