MEGAResFrom MEG, the Microbial Ecology Group

PH23S

The PH23S group of genes confer resistance to Phenicol through the mechanism, Phenicol-resistant 23S rRNA mutation.

References

    Sequences

    Download Sequences

    >>MEG_5781|Drugs|Phenicol|Phenicol-resistant_23S_rRNA_mutation|PH23S|RequiresSNPConfirmation
    GTGGCTACTGTGCCACCTGGTGGATAGCTCGGCTCGGATGCCGACGAAGGACGTGCCAAGCTGCGATAAGCCTGAGGGAG
    CCGCACGGAGGCTAAGAACTCAGGATCTCCTAATGGGAATCCCTATAACAATTGCCTTGCGCAATGGGGAACGGCCGGAA
    TTGAAGCATCTCAGTACGGCCAGGAAGAGAAATCGAATGAGACGCCGTTAGTAATGGCGAATGAACGCGGCACAGTCCAA
    ACCGAAGCCTTCGGGCAATGTGGTGTTCGGACTGACTTTCATCGTTTGACCGTTCGTGTGAAGTCTCCTGAAACGGAGCG
    CGATACAGGGTGACAGCCCCGTATCACGGACCAGTACGACGTGCGTCAGCTCCAGAGTAGCGGGGGTTGGAAATCCCTCG
    TGAATTGTGGCAGGCATCGACTGCCAAGACTAAGTACTCTCCGAGACCGATAGTGAACAAGTAGTGTGAACGAACGCTGA
    AAAGCACCCCACAAAGGGGGGTGAAATAGGGCTTGAAATCAGGTGGCGATGGAGCGACGGGGCATAAAAGGCCTCTCTGG
    GAACGACTTGAGTGCAAACTCATGGTAGGACCTGAGAGGAGCCGATGTTCCGTCGTACGTTTTGAAAAACGAGCTAGGGA
    GTGTGCCTGTTTGACGAGTCTAACCGGAGTATCCGGGAAGGCGTAGGGAAACCAATATGGCCGCGGCATTGCGAGGGCCA
    CCGTGTTCAAGCGCGGGGAGTCAAACGGGCACGACCCGAAACCCGGTGATCTACGCGTGGGCAAGGTGAAGCATGGCGAA
    AGCCATGTGGAGGCCTGTTAGGGTTGGTGTCTTTCAACACCCTCCCGTGACCTACGTGTAGGGGTGAAAGGCCCATCGAA
    CCGGGCAACAGCTGGTTCCAACCGAAACATGTCGAAGCATGACCTCTGCCGAGGTAGTTCGTGGGGTAGAGCGACCGATT
    GGGGAGTTCAACTCCGAGAGGAGTTGTCTCCCCTGTCAAACTCCAAACCTACGGACGCCGTCGACGCAGGGAATCCGGTG
    TGCGGGGTAAGCCTGTGCACCGTGAGGGAGACAACCCAGAGTTAGGTTAAGGTCCCAAAGTGCGAGCTAAGTGCGATTGA
    AGGTGGTCTCGAGCCCTAGACAGCCGGGAGGTGAGCTTAGAAGCAGCTACCCTCTAAGAAAAGCGTAACAGCTTACCGGC
    CGAGGTTCGAGGCGCCCAAAATGATCGGGGCTTAAGTTCGCCACCGAGACCTAACGGCACGGGTAACACCGTGATCCAGT
    AGGTTGGCATTCTGTTCGGGTGGAAGCTCGGGTGAGAACTCGAGTGGACCGAGTGGAAAAGAAAATCCTGGCCATAGTAG
    CAGCGTTAGTCGGGTAAGAATCCCGATGGCCGAAAGAGCAAGGGTTCCTCGGCAATGCTTATCAGCCGAGGGTTAGCCGA
    TCCTAAGGCCCGTCGTAATTCGAGCGGGTCAAAAGGGAAACTGGTTAATATTCCAGTGCCACCGTACATTGAAAGTCGAC
    GCCTCGGAGCAGCTTGAGCCGGGCATTCGCCCGGTCGAACCGTCGAAGTTCGTGGAAGCCGTAATGGCAGGAAGCGAACG
    AACGTCGGAACAGGGAAACTCAAGTCAATCTGGGGCCCGTGAAAAGGCGAGTACGGTGTTCGTACCGAGATCCGACACAG
    GTGCTCTGGCAGAGGAAGCCAAGGCCTGTCGGGAATAACCGACGTTAGGGAATTCGGCAAGTTAGTCCCGTAAGTTCGCG
    ATAAGGGATGCCTGCCACGCAATGAGGCAGGTCGCAGTGACTCGGAGGCTCCGACTGTCTAATAACAACATAGGTGACCG
    CAAATCCGCAAGGACGCGTACGGTCACTGAATCCTGCCCAGTGCGGGTATCTGAACACCCAGTACAATGGGGCGAAGGAC
    CCGTTAACGGCGGGGGTAACTATGACCCTCTTAAGGTAGCGTAGTACCTTGCCGCTTCAGTAGCGGCTTGCATGAATGGA
    TCAACGAGAGCCTCACTGTCCCAACGTTGGGCCCGGTGAACTGTACGTTCCAGTGCGGAGTCTGGAGACCCCCAAGGGGA
    AGCGAAGACCCTATAGAGCTTTACTGCAGGCTGTCGCTGGGACACGGTCGCTGATGTGCAGAGTAGGTAGGAGACGTTAC
    ACAGGTACGTGCGCTAGCACGCCACCGAGTCACACATGAAACACTACCCGTCAGTGACTGTGACCCTCACTCCGGGAGGA
    GGACACCGGTAGCCGGGCAGTTTGACTGGGGCGGTACGCGCTTGAAAAGATATCGAGCGCGCCCTAAGCCTATCTCAGCC
    GAGTCAGAGACTCGGCGAAGAGTGCAAGAGCATAAGATAGGCTGACAGTGTCCTACACAACGAGGGACGCTGACGCGAAA
    GCTGGTCTAGCGAACCAATTAGGCTGCTTGATGCGGCCAATTGCTGACAGAAAAGCTACCTTAGGGATAACAGAGTCGTC
    ACTCGCAAGAGCACATATCGACCGAGTGGCTGCTACCTCGATGTCGGTTCCCTCCATCCTGCCCGTGCAGAAGCGGGCAA
    GGGTGAGGTTGTTCGCCTATTAAAGGAGGTCGTGAGCTGGGTTTAGACCGTCGTGAGACAGGTCGGCTGCTATCTATTGG
    GGGTGTTTTGGTGCTTGACAGGAACGTTCGTATAGTACGAGAGGAACTACGAACGGGTGCCACTGGTGTATCGGTTGTCC
    GAGAGGGCATGTGCCGAGCAGCTACGCACCACGGGGTAAGAGCTGAATGCATCTAAGCTCGAAACCCACCTGGAAAAGAA
    GCACCACTGAGACCGCTCGTAGAAGACGAGTTCGATAGACTTGGGGTGTACGCGTCGAGGCAACGAGACGTTTAGCCCGC
    GAGTACTAACAGGTCAATGCCACAC