MEGAResFrom MEG, the Microbial Ecology Group

CFRA

The cfrA gene encodes a methyltransferase that causes multi-drug resistance, including resistance to the phenicols.

References

Sequences

Download Sequences

>MLS|CfrA|AM408573|10028-11077|1050|Phenicol|Florfenicol_methyltransferases|CFRA
ATGAATTTTAATAATAAAACAAAGTATGGTAAAATACAGGAATTTTTAAGAAGTAATAATGAGCCTGATTATAGAATAAA
ACAAATAACCAATGCGATTTTTAAACAAAGAATTAGTCGATTTGAGGATATGAAGGTTCTTCCAAAATTACTTAGGGAGG
ATTTAATAAATAATTTTGGAGAAACAGTTTTGAATATCAAGCTCTTAGCAGAGCAAAATTCAGAGCAAGTTACGAAAGTG
CTTTTTGAAGTATCAAAGAATGAGAGAGTAGAAACGGTAAACATGAAGTATAAAGCAGGTTGGGAGTCATTTTGTATATC
ATCACAATGCGGATGTAATTTTGGGTGTAAATTTTGTGCTACAGGCGACATTGGATTGAAAAAAAACCTAACTGTAGATG
AGATAACAGATCAAGTTTTATACTTCCATTTATTAGGTCATCAAATTGATAGCATTTCTTTTATGGGAATGGGTGAAGCT
CTAGCCAACCGTCAAGTATTTGATGCTCTTGATTCGTTTACGGATCCTAATTTATTTGCATTAAGTCCTCGTAGACTTTC
TATATCAACGATTGGTATTATACCTAGTATCAAAAAAATAACCCAGGAATATCCTCAAGTAAATCTTACATTTTCATTAC
ACTCACCTTATAGTGAGGAACGCAGCAAATTGATGCCAATAAATGATAGATACCCAATAGATGAGGTAATGAATATACTC
GATGAACATATAAGATTAACTTCAAGGAAAGTATATATAGCTTATATCATGTTGCCTGGTGTAAATGATTCTCTTGAGCA
TGCAAACGAAGTTGTTAGCCTTCTTAAAAGTCGCTATAAATCAGGGAAGTTATATCATGTAAATTTGATACGATACAATC
CTACAATAAGTGCACCTGAGATGTATGGAGAAGCAAACGAAGGGCAGGTAGAAGCCTTTTACAAAGTTTTGAAGTCTGCT
GGTATCCATGTCACAATTAGAAGTCAATTTGGGATTGATATTGACGCTGCTTGTGGTCAATTATATGGTAATTATCAAAA
TAGCCAATAG

>CARD|phgb|AM408573|10027-11077|ARO:3003441|cfrA|Phenicol|Florfenicol_methyltransferases|CFRA
CTATTGGCTATTTTGATAATTACCATATAATTGACCACAAGCAGCGTCAATATCAATCCCAAATTGACTTCTAATTGTGA
CATGGATACCAGCAGACTTCAAAACTTTGTAAAAGGCTTCTACCTGCCCTTCGTTTGCTTCTCCATACATCTCAGGTGCA
CTTATTGTAGGATTGTATCGTATCAAATTTACATGATATAACTTCCCTGATTTATAGCGACTTTTAAGAAGGCTAACAAC
TTCGTTTGCATGCTCAAGAGAATCATTTACACCAGGCAACATGATATAAGCTATATATACTTTCCTTGAAGTTAATCTTA
TATGTTCATCGAGTATATTCATTACCTCATCTATTGGGTATCTATCATTTATTGGCATCAATTTGCTGCGTTCCTCACTA
TAAGGTGAGTGTAATGAAAATGTAAGATTTACTTGAGGATATTCCTGGGTTATTTTTTTGATACTAGGTATAATACCAAT
CGTTGATATAGAAAGTCTACGAGGACTTAATGCAAATAAATTAGGATCCGTAAACGAATCAAGAGCATCAAATACTTGAC
GGTTGGCTAGAGCTTCACCCATTCCCATAAAAGAAATGCTATCAATTTGATGACCTAATAAATGGAAGTATAAAACTTGA
TCTGTTATCTCATCTACAGTTAGGTTTTTTTTCAATCCAATGTCGCCTGTAGCACAAAATTTACACCCAAAATTACATCC
GCATTGTGATGATATACAAAATGACTCCCAACCTGCTTTATACTTCATGTTTACCGTTTCTACTCTCTCATTCTTTGATA
CTTCAAAAAGCACTTTCGTAACTTGCTCTGAATTTTGCTCTGCTAAGAGCTTGATATTCAAAACTGTTTCTCCAAAATTA
TTTATTAAATCCTCCCTAAGTAATTTTGGAAGAACCTTCATATCCTCAAATCGACTAATTCTTTGTTTAAAAATCGCATT
GGTTATTTGTTTTATTCTATAATCAGGCTCATTATTACTTCTTAAAAATTCCTGTATTTTACCATACTTTGTTTTATTAT
TAAAATTCAT