MEGAResFrom MEG, the Microbial Ecology Group

CATP

The cat genes encode chloramphenicol acetyltransferases. Upregulation of the transcription of this gene is induced by the presence of chloramphenicol, and the gene is usually found on a plasmid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/6340955

Other Groups in Chloramphenicol acetyltransferases

Sequences

Download Sequences

>>MEG_1631|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATP|RequiresSNPConfirmation
atggtatttgaaaaaattgataaaaatagttggaacagaaaagagtattttgaccactactttgcaagtgtaccttgtac
atacagcatgaccgttaaagtggatatcacacaaataaaggaaaagggaatgaaactatatcctgcaatgctttattata
ttgcaatgattgtaaaccgccattcagagtttaggacggcaatcaatcaagatggtgaattggggatatatgatgagatg
ataccaagctatacaatatttcacaatgatactgaaacattttccagcctttggactgagtgtaagtctgactttaaatc
atttttagcagattatgaaagtgatacgcaacggtatggaaacaatcatagaatggaaggaaagccaaatgctccggaaa
acatttttaatgtatctatgataccgtggtcaaccttcgatggctttaatctgaatttgcagaaaggatatgattatttg
attcctatttttactatggggaaaattataaagaaggataacaaaattatacttcctttggcaattcaagttcatcacgc
agtatgtgacggatttcacatttgccgttttgtaaacgaattgcaggaattgataatagttactcaggtttgtctgtaa

>>MEG_1632|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CATP|RequiresSNPConfirmation
ATGGTATTTGAAAAAATTGATAAAAATAGTTGGAACAGAAAAGAGTATTTTGACCACTACTTTGCAAGTGTACCTTGTAC
ATACAGCATGACCGTTAAAGTGGATATCACACAAATAAAGGAAAAGGGAATGAAACTATATCCTGCAATGCTTTATTATA
TTGCAATGATTGTAAACCGCCATTCAGAGTTTAGGACGGCAATCAATCAAGATGGTGAATTGGGGATATATGATGAGATG
ATACCAAGCTATACAATATTTCACAATGATACTGAAACATTTTCCAGCCTTTGGACTGAGTGTAAGTCTGACTTTAAATC
ATTTTTAGCAGATTATGAAAGTGATACGCAACGGTATGGAAACAATCATAGAATGGAAGGAAAGCCAAATGCTCCGGAAA
ACATTTTTAATGTATCTATGATACCGTGGTCAACCTTCGATGGCTTTAATCTGAATTTGCAGAAAGGATATGATTATTTG
ATTCCTATTTTTACTATGGGGAAATATTATAAAGAAGATAACAAAATTATACTTCCTTTGGCAATTCAAGTTCATCACGC
AGTATGTGACGGATTTCACATTTGCCGTTTTGTAAACGAATTGCAGGAATTGATAAATAGTTAA