MEGAResFrom MEG, the Microbial Ecology Group

CAT

The cat genes encode chloramphenicol acetyltransferases. Upregulation of the transcription of this gene is induced by the presence of chloramphenicol, and the gene is usually found on a plasmid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/6340955

Other Groups in Chloramphenicol acetyltransferases

Sequences

Download Sequences

>>MEG_1548|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGAACTTTAATAAAATTGATTTAGACAATTGGAAGAGAAAAGAGATATTTAATCATTATTTGAACCAACAAACGACTTT
TAGTATAACCACAGAAATTGATATTAGTGTTTTATACCGAAACATAAAACAAAAAAGATATAAATTTTATCCTGCATTTG
TTTTCTTAGTGACAAGGGTGATAAACTCAAATACAGCTTTTAGAACTGGTTACAATAGCGAGGGAGAGTTAGGCTATTGG
GATAAGTTAGACCCACTATACACAATTTTTGATAGTGTATCTAAAACATTCTCTGGTATTTGGACTCCTGCAAGGAATGA
CTTCAAAGAGTTTTATGATTTATACCTTTCTGATGTAGAGAAATATAATGGTTCGGGGAAATTGTTTCCCAAAACACCTA
TACCCGAAAATGCTTTTTCTATTTCTATTATTCCATGGACTTCATTTACTGGGTTTAACTTAAATATCAATAATAATAGT
AATTATCTTCTACCCATTATTACAGCAGGAAAATTCATTAATAAAGGTAATTCAATATATTTACCGCTATCTTTACAGGT
ACATCATTCTGTTTGTGATGGTTATCATGCAGGATTGTTTATGAACTCTATTCAGGAATTGGCAGATAGGCCTAATGACT
GGCTTTTTTAA

>>MEG_1549|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGACCAACTATTTTGAAAGTCCATTTAAAGGCAAACTGCTGGCCGACCAGGTAAAGAACCCGAACATCAAAGTCGGACG
GTATAGCTATTATTCCGGCTATTACCATGGCCATTCGTTTGACGAGTGCGCTCGCTTTCTCTTGCCAGATCGCGATGACA
TCGACCAACTGATCGTTGGTAGCTTCTGTTCCATCGGCACGGGCGCCTCCTTCATCATGGCCGGAAATCAGGGGCACCGT
TATGACTGGGCGTCTTCTTTTCCCTTCTTCTACATGAAAGAGGAGCCAGCATTCTCGGGCGCACTTGATGCATTCCAAAA
AGCCGGTGACACAGTCATCGGAAGTGATGTCTGGATAGGCTCTGAGGCCATGATCATGCCCGGCATCAACGTCGGTCATG
GCGCTGTGATTGGAAGCCGCGCTTTGGTCACGAAAGATGTGGAGCCGTACACTATCGTTGGCGGAAATCCCGCCAAACCG
ATCAAGAAACGCTTCTCCGACGAGGAGATCGCCATGCTTTTGAAAATGAATTGGTGGGATTGGCCAACTGAAAAAATTGA
GGAAGCAATGCCTTTGCTATGCTCATCCAACATCGTTGGGCTGCATCGATACTGGCAAGGCTTTGCCGTCTAA

>>MEG_1550|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGGAAATTTTAACACTATTAATTCGTGATACCATGGGATCGAAAAGAATATTTTTGAACCCCTATTTCCAGCAGCAGCC
AACATTCAGTCTGACGAATGAAATTAATATAACTATACTTATGAAGAACTTAAAGAAAAAGCATTATAAGTTATATCCTG
CGTTTATTTTTATGGTGACAAAAATCGTGAACGCCCATAGAGAATTTAGAATAAATTTTAACTCAGAAGGAAATTTAGGT
TACTGGACGGAGATTTGCCCACTCTATACCATTTTTGATAACAAATCACACACATTTTCTGGCATCTGGTCACCAAACTT
AACTATTTTTTCTGAGTTTCATTCTAAATATGAAAATGATGCAGAAAGATACAATGGCACGAGGAGATTATTTCCAAAAA
AACCAATACCAGATAACCCTATTCCGATTTCTATGATTCCTTGGAGTTCTTTTACAGCATTTAATCTAAATATAAATAAT
GGCGGAGATTTTCTCTTACCCATAATAACTGGAGGGAAGTATTCACAAGTAAATGATGAATTATTCCTGCCTGTCTCTAT
CCAAAATGCATCATGCCTATTTGTGATGGCTACCATGCAAAGTGTTTTTATCAATGACTTACAAAACCTTGTTGATGAAA
GTGAAGACTGGATTTACCTGGTCGTTAGTGATGAATGGTATTATTAA

>>MEG_1551|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGAAGTTTCACATTATTAATGTTGAAGAGTGGACGAGAAAGCCTTATTATGAGCATTATCTTCGATCGAATAAATGCAC
CTTCAGCATCACCGTGGATATCGACATTACTCGCTTGTTGTATTCGTTAAAAGCTAATGGATTCAAGCTTTATCCAGCTT
TTATTTATATGGTTACAAGAGTTGTCAATGACCGGGTTGAATTCAAAACTTCCTTTAGTCCCGAAGGGGAATTGGGTTAC
TGGGATCGGATGACGCCGAGTTATACCTTTTTCCATAACGATGACCATACCTTCTCCTGTTTATGGACAGCATTTTCGAA
TGATTTCTATCGATTTCATGATCATTACGAGCAGGACATGGAGCAATATCGGGATACAAAAGGGCTGTTTGTTAAAGAGA
ATCCACCGCCGAACACGTTTCCCATATCCATGATACCCTGGACAAGCTTTAGCGGATTTAATCTAAACATTGTCAATGAA
GCAGACTATCTTCTTCCCATCATAACCGGCGGAAAATATACCGAGCAGGGTGGCCGTGTTCTGCTTCCAGTCTCATTGCA
GGTGCACCATGCTGTGTGTGATGGTTATCATGCCAGCATGTTCTTTAAGGAGTTGCAGAGCTTGGCGGATTCTTTTGAAG
ATTGGTTAACTTAA

>>MEG_1552|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGAAATTTCAGCGAATCGATCTAGATAATTGGAGCAGAAGGTCTTATTTCGAGCATTATCTGAACCGAGTGAATTGCAC
CTTCAGTATGACTGCCAACATAGATATAACGGAATTGCTGCCCGCTCTACGGCAAAAGGAGATGAAGCTGTACCCGGCTT
TTCTGTATATGGTGACAAACGCTGTCAATGCGCATCGTGAATTTCGGACTTCCTTCCATGCGGATGGCGAGTTGGGCTAT
TGGGAGAGCATGATACCCAGCTATACTTTTTTTCACCAGGATGATCAAACTTTTTCTACGATGTGGACGGAATTCGCTGA
CGAGTTCCCTGTGTTTTATCAAAATTACGTAGCGGATATGAAAAAGTATGGGGACAACAAAGGTCTTGTGGCAAAAGAGT
TGGAACCGCCTTACACTTTCCCTGTCTCGTGTATTCCCTGGGTGAGCTTCAGTGGGTTTAATCTGAATATTTCGGGAGAT
GGGCGATATTTGCTGCCAATCATTACGAGCGGAAAGTATTTCGGGCAAGAAGGCAAAACGTTATTGCCTGTTTCTTTGCA
GGTCCATCATGCGGTTTGTGATGGCTATCACGCGAGCCTGTTCATCCATGATCTGCAAAAATGGGCAACAAACTATAAGG
AATGGTTAGGTGTCGAGTGA

>>MEG_1553|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGCAATTCACAAAGATTGATATAAATAATTGGACACGAAAAGAGTATTTCGACCACTATTTTGGCAATACGCCCTGCAC
ATATAGTATGACGGTAAAACTCGATATTTCTAAGTTGAAAAAGGATGGAAAAAAGTTATACCCAACTCTTTTATATGGAG
TTACAACGATCATCAATCGACATGAAGAGTTCAGGACCGCATTAGATGAAAACGGACAGGTAGGCGTTTTTTCAGAAATG
CTGCCTTGCTACACAGTTTTTCATAAGGAAACTGAAACCTTTTCGAGTATTTGGACTGAGTTTACAGCAGACTATACTGA
GTTTCTTCAGAACTATCAAAAGGATATAGACGCTTTTGGTGAACGAATGGGAATGTCCGCAAAGCCTAATCCTCCGGAAA
ACACTTTCCCTGTTTCTATGATACCGTGGACAAGCTTTGAAGGCTTTAACTTAAATCTAAAAAAAGGATATGACTATCTA
CTGCCGATATTTACGTTTGGGAAGTATTATGAGGAGGGCGGAAAATACTATATTCCCTTATCGATTCAAGTGCATCATGC
CGTTTGTGACGGCTTTCATGTTTGCCGTTTTTTGGATGAATTACAAGACTTGCTGAATAAATAA

>>MEG_1554|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGAAATTTAATTTGATAGATATTGAGGATTGGAATAGAAAGCCATACTTTGAGCATTATTTAAATGCGGTTAGGTGCAC
TTACAGTATGACTGCAAATATAGAGATAACTGGTTTACTGCGTGAAATTAAACTTAAGGGCCTGAAACTGTACCCTACGC
TTATTTATATCATCACAACTGTGGTTAACCGTCACAAGGAGTTCCGCACCTGTTTTGATCAAAAAGGTAAGTTAGGATAC
TGGGATAGTATGAACCCAAGTTATACTGTCTTTCATAAGGATAACGAAACTTTTTCAAGTATTTGGACAGAGTATGACGA
GAACTTCCCACGTTTTTACTATAATTACCTTGAGGATATTAGAAACTATAGCGACGTTTTGAATTTCATGCCTAAGACAG
GTGAACCTGCTAATACAATTAATGTGTCCAGCATTCCTTGGGTGAATTTTACCGGATTCAACCTGAATATATACAATGAT
GCAACATATCTAATCCCTATTTTTACTTTGGGTAAGTATTTTCAGCAGGATAATAAAATTTTATTACCTATGTCTGTACA
GGTGCATCATGCGGTTTGCGACGGTTATCATATAAGCAGATTTTTTAATGAGGCACAGGAATTAGCGTCAAATTATGAGA
CATGGTTAGGAGAAAAATAA

>>MEG_1555|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGGAAAACTATTTCGAAAGCCCATTCCGGGGCATTACACTCGACAAGCAGGTGAAGAGCCCGAACCTGGTGGTCGGAAA
ATACAGCTATTATTCCGGCTATTACCACGGCCACAGTTTCGAGGATTGCGCCCGGTACCTGCTGCCCGATGAGGGCGCGG
ACAGGCTGGTGATCGGAAGCTTCTGCTCGATCGGTTCGGGCGCCGCCTTCATCATGGCGGGCAATCAGGGGCACCGCAAC
GAATGGATCAGTACCTTCCCGTTCTTCTTCATGCCGGAGGTGCCGGAATTCGAGAATGCCGCCAACGGTTATCTGCCGGC
GGGCGACACCGTCATCGGCAACGATGTCTGGATCGGTTCGGAAGCGATCATCATGCCCGGCATCACCGTCGGTGATGGCG
CGGTGATCGGAACGCGGGCGCTGGTGACGAAGGACGTCGAGCCCTACGCCATCGTCGGCGGCAACCCCGCAAAAACGATC
CGCAAGCGGTTTGACGACGATAGCATCGCCCTGCTGCTCGAGATGAAATGGTGGGGCTGGCCGGCGGAGCGGCTGAAAGC
TGCAATGCCGCTGATGACCAGCGGCAATGTCGCGGCGCTCTATCGTTTCTGGCGGTCCGATAGCCTCTAG

>>MEG_1556|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGAATTTTAATTTAATAGATATTAATCATTGGAGTAGAAAGCCATACTTTGAACATTATTTAAACAATGTGAAATGTAC
TTACAGTATGACTGCCAATATAGAAATAACTGATTTATTGTATGAAATTAAACTTAAAAATATTAAATTTTATCCTACAC
TTATTTATATGATTGCAACTGTGGTTAATAATCATAAAGAATTCCGTATTTGTTTTGATCATAAAGGTAGTTTAGGATAT
TGGGATAGCATGAATCCAAGCTATACTATTTTTCATAAAGAAAACGAAACATTTTCAAGTATTTGGACGGAATATAACAA
AAGTTTTTTACGTTTTTATAGTGATTATCTTGACGATATAAAAAACTATGGAAATATCATGAAGTTTACTCCGAAATCAA
ATGAACCTGACAATACATTTTCTGTATCAAGTATTCCTTGGGTGAGTTTTACAGGATTTAACTTGAATGTTTATAATGAA
GGAACATATTTAATTCCTATTTTTACTGCAGGAAAGTATTTCAAACAAGAAAATAAAATATTTATTCCTATATCAATACA
AGTACATCATGCTATCTGTGACGGTTATCATGCTAGTAGATTTATTAATGAAATGCAAGAATTAGCATTTAGTTTTCAAG
AATGGTTAGAAAATAAATAA

>>MEG_1557|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGGGCAACTATTTCGAGAGCCCCTTCAGGGGCAAGCTGCTCTCGGAACAGGTCAGCAACCCGAACATACGGGTGGGGCG
CTACAGCTACTACTCCGGCTACTATCACGGGCATTCCTTCGACGACTGCGCCCGCTACCTGATGCCGGACCGCGACGACG
TGGACAAGCTGGTCATCGGCAGTTTCTGCTCGATCGGCAGTGGCGCCGCCTTCATCATGGCCGGCAACCAGGGACACCGC
GCCGAATGGGCGTCGACCTTCCCCTTCCACTTCATGCACGAAGAGCCTGTCTTCGCCGGCGCCGTGAACGGCTATCAGCC
AGCCGGCGACACGCTGATCGGCCATGACGTCTGGATCGGTACCGAGGCGATGTTCATGCCCGGCGTACGGGTCGGCCACG
GAGCCATCATCGGCAGCCGCGCGCTGGTGACCGGCGATGTCGAGCCCTATGCCATCGTCGGCGGTAACCCGGCCCGGACC
ATTCGTAAGCGCTTTTCCGATGGCGATATCCAGAACCTGCTGGAAATGGCCTGGTGGGACTGGCCACTGGCCGATATCGA
GGCAGCCATGCCACTGCTGTGTACTGGGGATATCCCCGCCTTGTACCGGCACTGGAAACAGCGCCAGGCCACGGCCTGA

>>MEG_1558|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGGAGTTTCGTTTGGTTGATCTGAAAACATGGAAAAGAAAAGAGTACTTTACGCATTATTTTGAATCTGTGCCTTGCAC
ATATAGCATGACCGTAAAGCTGGATATTACTACGATAAAAACCGGTAAAGCGAAATTGTATCCCGCCCTTTTGTATGCCG
TTTCAACAGTAGTTAACCGGCATGAAGAATTCCGTATGACTGTGGACGATGAAGGTCAAATCGGGATATTTAGTGAAATG
ATGCCGTGCTATACAATTTTCCAAAAGGACACGGAGATGTTTTCAAATATCTGGACCGAGTATATCGGTGATTATACGGA
GTTCTGCAAACAGTATGAAAAAGATATGCAGCAATACGGTGAAAACAAGGGCATGATGGCAAAGCCAAATCCGCCTGTGA
ATACTTTCCCAGTCTCTATGATTCCATGGACAACCTTTGAAGGATTTAATTTAAATTTGCAAAAGGGATATGGGTATCTG
CTTCCCATTTTTACGTTTGGACGATATTATGAAGAAAACGGGAAATATTGGATTCCGTTATCTATTCAGGTACATCATGC
GGTATGCGATGGATTTCATACCTGCCGTTTTATCAATGAATTACAGGATGTAATCCAAAGTTTACAAAACCATGGAGGTG
ACGAAGAATGA

>>MEG_1559|Drugs|Phenicol|Chloramphenicol_acetyltransferases|CAT
ATGAACTTTAATAAAATTGATTTAGACAATTGGAAGAGAAAAGAGATATTTAATCATTATTTGAACCAACAAACGACTTT
TAGTATAACCACAGAAATTGATATTAGTGTTTTATACCGAAACATAAAACAAGAAGGATATAAATTTTACCCTGCATTTA
TTTTCTTAGTGACAAGGGTGATAAACTCAAATACAGCTTTTAGAACTGGTTACAATAGCGACGGAGAGTTAGGTTATTGG
GATAAGTTAGAGCCACTTTATACAATTTTTGATGGTGTATCTAAAACATTCTCTGGTATTTGGACTTCTGTAAAGAATGA
CTTCAAAGAGTTTTATGATTTATACCTTTCTGATGTAGAGAAATATAATGGTTCGGGGAAATTGTTTCCCAAAACACCTA
TACCTGAAAATGCTTTTTCTCTTTCTATTATTCCATGGACTTCATTTACTGGGTTTAACTTAAATATCAATAATAATAGT
AATTACCTTCTACCCATTATTACAGCAGGAAAATTCATTAATAAAGGTAATTCAATATATTTACCGCTATCTTTACAGGT
ACATCATTCTGTTTGTGATGGTTATCATGCAGGATTGTTTATGAACTCTATCAGGAATTGTCAGATAGGCCTAATGACTG
GCTTTTATAATATAGATAAGCCGACTGTACTTTTTACAGTCGGTTTTCTAATGTCACTAACCTGCCCGTTAATTTAA