Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

NCRCN

The NCRCN group of genes confer resistance to Nickel resistance through the mechanism, Nickel MFS efflux pump.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Nickel MFS efflux pumps

    Sequences

    Download Sequences

    >>MEG_4126|Metals|Nickel_resistance|Nickel_MFS_efflux_pumps|NCRCN
    ATGACTGATTTTTCCACTCTTTTACAGCAAGGCGTGGCCAATGCCTGGCTGTTCATCCCCAGCGCTATTTTGCTCGGTGC
    GCTTCACGGACTGGAGCCAGGGCATTCCAAAACGATGATGGCCGCCTTTATTGTGGCCATCCGGGGAACGGTCAAGCAAG
    CGGTATTACTGGGGCTTGCCGCGACAATTTCTCATACGTCTGTTGTCTGGCTCATTGCGTTCGGCGGAATGTATATCAGT
    CAGAAATTCACTGCTGAATCAGCCGAACCCTGGTTTCAGCTGATTTCCGCCGTCATCATTCTCGGTACGGCGGCATGGAT
    GTTCTGGCGAACCTGGCGCGGCGAAAAGCTGTGGAAGATGGAGCAGGAAGAGGAACACAGCCACGGTCATCACGATCATG
    ACGAAACCCGCATCATCGATACGGGCCATGGCAGCGTTGAACTCTCGATTTTCGAAGAAGGACAACCCCCTCACTGGCGT
    TTACGCTCGCTCAGCGGCAAGAAATGGGAAGCTCGCGACATTTCTCTGGTGACCAACCGTGGTCCAGGGACATTTTCACA
    GGTATTTGATTTCGTCGAAAAAGACGGGTTTATGGAATCGGCCCTGGCGATCCCGGAGCCACACAGCTTTGATGTTCGCC
    TGTCTTTAGGCCATCGCGGCCATGTGCATGATTATGATGTGGAATTCCGTGAACATGAACACGACCACGATCATTCCTCG
    CTGGAAGGTCTGGATGTTAATTCTCGCGAATATCAGGATGCTCACGAAAAAGCGCATGCGAACGACATCAAAAAACGTTT
    TGCGAATCGCAGCGTAACCACCGGACAAATAATCCTGTTCGGCCTGACCGGCGGCCTTATTCCTTGCCCGGCAGCCATTA
    CCGTTTTGCTGCTCTGCATCCAGGTGAAGGAATTTACGCTCGGTGCCGCGCTGGTACTGTGTTTCAGCATCGGTTTAGCG
    ATCACGCTGGTTTCAGTGGGCGCAGCGGCGGCTTTCAGCGTTCGTCAGGCAACCAAACGCTGGAGTGGCCTGGATACGCT
    GGCGCGGCGGGCTCCATACTTCTCAAGCGTACTGATTGCACTTGTCGGCATTTACATGGGCTATCACGGCTGGATCGGCG
    TAACGAGCTGA