MEGAResFrom MEG, the Microbial Ecology Group

PNCA

The pncA gene encodes a pyrazinamidase that converts pyrazinamide to its active form in Mycobacterium tuberculosis. Specific mutations in pncA can result in loss of typical function and therefore resistance to pyrazinamide.

References

Sequences

Download Sequences

>CARD|pvgb|AL123456|2288680-2289241|ARO:3003394|Mycobacterium|Mycobacterium_tuberculosis-specific_Drug|Pyrazinamide-resistant_pncA|PNCA|RequiresSNPConfirmation
TCAGGAGCTGCAAACCAACTCGACGCTGGCGGTGCGCATCTCCTCCAGCGCGGCGACGGTGGTATCGGCCGACACACCCG
CTGTCAGGTCCACCAGCACCCTGGTGGCCAAGCCATTGCGTACCGCGTCCTCGGCCGTCTGGCGCACACAATGATCGGTG
GCAATACCGACCACATCGACCTCATCGACGCCGCGTTGCCGCAGCCAATTCAGCAGTGGCGTGCCGTTCTCGTCGACTCC
TTCGAAGCCGCTGTACGCTCCGGTGTAGGCACCCTTGTAGAACACCGCCTCGATTGCCGACGTGTCCAGACTGGGATGGA
AGTCCGCGCCGGGAGTACCGCTGACGCAATGCGGTGGCCACGACGAGGAATAGTCCGGTGTGCCGGAGAAGTGGTCACCC
GGGTCGATGTGGAAGTCCTTGGTTGCCACGACGTGATGGTAGTCCGCCGCTTCGGCCAGGTAGTCGCTGATGGCGCGGGC
CAGCGCGGCGCCACCGGTTACCGCCAGCGAGCCACCCTCGCAGAAGTCGTTCTGCACGTCGACGATGATCAACGCCCGCA
TA