Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

RPSA

The RPSA group of genes confer resistance to Mycobacterium tuberculosis-specific Drug through the mechanism, Pyrazinamide-resistant rpsA.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Pyrazinamide-resistant mutant

    Sequences

    Download Sequences

    >>MEG_6142|Drugs|Mycobacterium_tuberculosis-specific_Drug|Pyrazinamide-resistant_mutant|RPSA|RequiresSNPConfirmation
    ATGCCGAGTCCCACCGTCACCTCGCCGCAAGTAGCCGTCAACGACATAGGCTCTAGCGAGGACTTTCTCGCCGCAATAGA
    CAAAACGATCAAGTACTTCAACGATGGCGACATCGTCGAAGGCACCATCGTCAAAGTGGACCGGGACGAGGTGCTCCTCG
    ACATCGGCTACAAGACCGAAGGCGTGATCCCCGCCCGCGAACTGTCCATCAAGCACGACGTCGACCCCAACGAGGTCGTT
    TCCGTCGGTGACGAGGTCGAAGCCCTGGTGCTCACCAAGGAGGACAAAGAGGGCCGGCTCATCCTCTCCAAGAAACGCGC
    GCAGTACGAGCGTGCCTGGGGCACCATCGAGGCGCTCAAGGAGAAGGACGAGGCCGTCAAGGGCACGGTCATCGAGGTCG
    TCAAGGGTGGCCTGATCCTCGACATCGGGCTGCGCGGTTTCCTGCCCGCCTCGCTGGTGGAGATGCGCCGGGTGCGCGAC
    CTGCAGCCCTACATCGGCAAGGAGATCGAGGCCAAGATCATCGAGCTGGACAAGAACCGCAACAACGTGGTGCTGTCCCG
    TCGCGCCTGGCTGGAGCAGACCCAGTCCGAGGTGCGCAGCGAGTTCCTGAATAACTTGCAAAAAGGCACCATCCGAAAGG
    GTGTCGTGTCCTCGATCGTCAACTTCGGCGCGTTCGTCGATCTCGGCGGTGTGGACGGTCTGGTGCATGTCTCCGAGCTA
    TCGTGGAAGCACATCGACCACCCGTCCGAGGTGGTCCAGGTTGGTGACGAGGTCACCGTCGAGGTGCTCGACGTCGACAT
    GGACCGTGAGCGGGTTTCGTTGTCACTCAAGGCGACTCAGGAAGACCCGTGGCGGCACTTCGCCCGCACTCACGCGATCG
    GGCAGATCGTGCCGGGCAAGGTCACCAAGTTGGTTCCGTTCGGTGCATTCGTCCGCGTCGAGGAGGGTATCGAGGGCCTG
    GTGCACATCTCCGAGCTGGCCGAGCGTCACGTCGAGGTGCCCGATCAGGTGGTTGCCGTCGGCGACGACGCGATGGTCAA
    GGTCATCGACATCGACCTGGAGCGCCGTCGGATCTCGTTGTCGCTCAAGCAAGCCAATGAGGACTACACCGAGGAGTTCG
    ACCCGGCGAAGTACGGCATGGCCGACAGTTACGACGAGCAGGGCAACTACATCTTCCCCGAGGGCTTCGATGCCGAAACC
    AACGAATGGCTTGAGGGATTCGAAAAGCAGCGCGCCGAATGGGAAGCTCGGTACGCCGAGGCCGAGCGCCGGCACAAGAT
    GCACACCGCGCAGATGGAGAAGTTCGCCGCCGCCGAGGCGGCTGGACGCGGCGCGGACGATCAGTCGTCGGCCAGTAGCG
    CACCGTCGGAAAAGACCGCGGGTGGATCACTGGCCAGCGACGCCCAGCTGGCGGCCCTGCGGGAAAAACTCGCCGGCAGC
    GCTTGA