MEGAResFrom MEG, the Microbial Ecology Group

PNCA

The pncA gene encodes a pyrazinamidase that converts pyrazinamide to its active form in Mycobacterium tuberculosis. Specific mutations in pncA can result in loss of typical function and therefore resistance to pyrazinamide.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC89721/

Other Groups in Pyrazinamide-resistant mutant

Sequences

Download Sequences

>>MEG_5803|Drugs|Mycobacterium_tuberculosis-specific_Drug|Pyrazinamide-resistant_mutant|PNCA|RequiresSNPConfirmation
ATGCGGGCGTTGATCATCGTCGACGTGCAGAACGACTTCTGCGAGGGTGGCTCGCTGGCGGTAACCGGTGGCGCCGCGCT
GGCCCGCGCCATCAGCGACTACCTGGCCGAAGCGGCGGACTACCATCACGTCGTGGCAACCAAGGACTTCCACATCGACC
CGGGTGACCACTTCTCCGGCACACCGGACTATTCCTCGTCGTGGCCACCGCATTGCGTCAGCGGTACTCCCGGCGCGGAC
TTCCATCCCAGTCTGGACACGTCGGCAATCGAGGCGGTGTTCTACAAGGGTGCCTACACCGGAGCGTACAGCGGCTTCGA
AGGAGTCGACGAGAACGGCACGCCACTGCTGAATTGGCTGCGGCAACGCGGCGTCGATGAGGTCGATGTGGTCGGTATTG
CCACCGATCATTGTGTGCGCCAGACGGCCGAGGACGCGGTACGCAATGGCTTGGCCACCAGGGTGCTGGTGGACCTGACA
GCGGGTGTGTCGGCCGATACCACCGTCGCCGCGCTGGAGGAGATGCGCACCGCCAGCGTCGAGTTGGTTTGCAGCTCCTG
A