MEGAResFrom MEG, the Microbial Ecology Group

THYA

The THYA group of genes confer resistance to Mycobacterium tuberculosis-specific Drug through the mechanism, Para-aminosalicylic acid resistant mutation.

Other Groups in Para-aminosalicylic acid resistant mutation

Sequences

Download Sequences

>MEG_7262|Drugs|Mycobacterium_tuberculosis-specific_Drug|Para-aminosalicylic_acid_resistant_mutation|THYA|RequiresSNPConfirmation
GTGACGCCATACGAGGACCTGCTGCGCTTCGTGCTCGAAACGGGTACGCCCAAATCCGACCGCACCGGCACCGGAACCCG
CAGCCTGTTCGGCCAGCAGATGCGCTATGATTTGTCGGCCGGTTTCCCGCTGCTCACTACCAAGAAAGTCCATTTCAAAT
CGGTAGCCTACGAGCTGCTGTGGTTTTTGCGCGGCGATTCCAATATCGGTTGGCTGCACGAGCACGGAGTCACCATCTGG
GACGAATGGGCAAGTGATACAGGCGAACTCGGGCCGATCTACGGTGTACAATGGCGATCGTGGCCGGCTCCATCCGGTGA
GCACATCGACCAGATCAGCGCGGCGCTGGATTTGCTGCGCACCGATCCCGATTCCCGGCGCATCATCGTGTCGGCCTGGA
ACGTCGGCGAAATCGAGCGGATGGCGCTGCCGCCCTGTCATGCGTTCTTCCAGTTCTACGTCGCCGATGGCCGGCTGAGC
TGTCAGCTCTACCAACGCAGCGCCGACCTGTTTCTGGGTGTGCCGTTCAACATCGCCAGCTATGCGTTGCTCACCCACAT
GATGGCCGCCCAGGCCGGCTTGTCGGTCGGCGAGTTCATCTGGACCGGTGGCGACTGCCACATCTACGACAATCACGTCG
AGCAAGTACGGCTGCAGCTCAGCCGCGAGCCGCGGCCATATCCGAAACTACTTCTAGCCGACCGGGATTCAATCTTCGAG
TACACCTATGAAGACATCGTTGTGAAGAACTACGATCCGCATCCGGCGATCAAAGCTCCAGTCGCGGTATGA