MEGAResFrom MEG, the Microbial Ecology Group

RIBD

The RIBD group of genes confer resistance to Mycobacterium tuberculosis-specific Drug through the mechanism, Para-aminosalicylic acid resistant mutation.

References

    Other Groups in Para-aminosalicylic acid resistant mutant

    Sequences

    Download Sequences

    >>MEG_6055|Drugs|Mycobacterium_tuberculosis-specific_Drug|Para-aminosalicylic_acid_resistant_mutant|RIBD|RequiresSNPConfirmation
    ATGCCCGACTCTGGTCAGCTCGGAGCCGCTGACACCCCGCTAAGGCTGCTCAGCTCGGTGCATTACCTCACCGACGGCGA
    ACTCCCCCAGCTTTACGACTATCCGGATGACGGCACCTGGTTGCGGGCGAACTTCATCAGCAGCTTGGACGGCGGCGCTA
    CCGTCGATGGCACCAGCGGGGCGATGGCCGGGCCCGGCGACCGATTCGTCTTCAACCTGTTGCGTGAACTTGCCGACGTC
    ATCGTGGTCGGCGTGGGCACCGTGCGCATTGAGGGCTACTCCGGCGTCCGGATGGGTGTCGTCCAGCGCCAGCACCGGCA
    GGCCCGAGGCCAAAGCGAAGTTCCGCAACTGGCAATCGTCACCAGGTCCGGTCGCCTTGACCGTGACATGGCGGTATTCA
    CCCGGACCGAGATGGCACCGTTGGTGCTCACCACCACGGCGGTCGCCGATGACACGCGCCAGCGGCTCGCGGGCCTCGCC
    GAGGTGATCGCGTGCTCCGGCGACGATCCGGGCACGGTCGATGAGGCAGTGCTCGTGTCCCAGCTCGCGGCTCGCGGTCT
    GCGCCGGATCCTTACCGAAGGCGGGCCGACGTTGCTCGGGACATTCGTCGAGCGTGACGTGCTCGACGAGCTGTGTCTGA
    CGATCGCCCCCTACGTCGTCGGCGGCCTGGCGCGCCGCATAGTGACGGGACCCGGGCAGGTGCTGACCCGGATGCGCTGT
    GCCCATGTCCTCACCGACGACTCCGGCTACCTGTACACCCGCTACGTCAAGACCTGA