MEGAResFrom MEG, the Microbial Ecology Group

NDH

The ndh gene encodes a NADH dehydrogenase that, when specific mutations are present, results in coresistance of ethionamide and isoniazid in Mycobacterium tuberculosis.

References

Sequences

Download Sequences

>CARD|pvgb|AL123456|2101650-2103042|ARO:3003461|Mycobacterium|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_ndh|NDH|RequiresSNPConfirmation
CTAGCTGGCCACCTTAGCGCTTGCCGCTGAGCCCTGCGCCTCGGCGGCCAGCTCGGCCAGCTGTTCGAGCCGCGTTCGCG
CAAATGCCTGCTGGTCGGTGATGGTCAGCTGGCCGCGGCGAGTACTGAGGAAAGTCACCGTCCACGACAGCAGAGTGGTG
ATCTTGGTCTTGAACCCGATCAGGTACGCCAGGTGCAGCACCAGCCAAATCAGCCAGGCGATAAAGCCGCTGAACTCAAC
GGGACCGATCTTGGCCACCGCCGAAAACCTCGAAACCGTGGCCATCGATCCCTTGTCGAAGTACTGGAATGGCTCACGCT
CCGCCGGGTTGGCGCCGGCCAGTTCGGCCTTGATCGTGCTGGCGACGTATTTCGCCCCCTGGATGGCGCCCTGCGCCACA
CCCGGCACACCCTCCACAGCGGCCATATCGCCCACCACGAACACGTTCGGGTACCCGGGAATGGACAGGTCGGGCAGCAC
TTGGACCCGGCCGGCCCGGTCGAGCTCAACCCGTGATTGCTCGGCAAGGTCCCTGCCCAACCGACTGGCCGAAACCCCGG
CCGACCAGACCTTGCAGGCCGACTCGATGCGCCGGACGGTGCCGTCGGAGTCCTTGACGGTGATGCCGTTGCGGTCGACG
TCGGTGACCATCGCACCCAGCTGGATTTCCACGCCCAGCTTCTGCAACCGGGCAGCCGCCCGCTGACCGAGCTTTGCGCC
CATCGGTGGCAGCACCGCCGGGGCGGCGTCAAGCAGAATCACCCGCGCCTTGGTCGAGTCGATGTGCCGGAATGCGCCCT
TCAACGTGTGCTCGGCCAGCTCGGCGATCTGTCCGGCCATTTCAACACCGGTGGGGCCAGCCCCGACAACGGTGAATGTC
AGTAGCTTGGCCCGCCGTTCCGGATCGCTGGACCGTTCGGCTTGCTCGAAAGCGCTCAATATGCGGCCACGCAACTCCAA
CGCGTCGTCGATGGACTTCATGCCGGGTGCGAATTCGGCGAAATGGTCGTTGCCGAAATAAGACTGGCCAGCACCCGCGG
CGACGATCAGGCTGTCGTAGGGGGTTTGGTAGGTGTGACCGAGCAATTCCGAGACGACGCACTGCCCGGCCAGGTCGATG
TGGGTGACGTTGCCCAACAGTACCTGGACATTGCGCTGCTTACGCAGCACGACCCGGGTCGGCGGAGCGATTTCTCCCTC
GGAGATAATCCCGGTGGCCACTTGGTACAGCAGCGGCTGGAACAGGTGATGGGTGGTGCGCGCGATCAGCTTGATGTCAA
CGTCGGCCCGCTTGAGCTTCTTTGCCGCGTTTAGCCCGCCGAACCCAGATCCGATGATCACAACTCGATGCCTACGAGGT
GGTTGCGCTGTGGGTTCTTGCTGGGGACTCATG