MEGAResFrom MEG, the Microbial Ecology Group

KATG

The KATG group of genes confer resistance to Mycobacterium tuberculosis-specific Drug through the mechanism, Isoniazid-resistant mutation.

Sequences

Download Sequences

>MEG_3446|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutation|KATG|RequiresSNPConfirmation
GTGCCCGAGCAACACCCACCCATTACAGAAACCACCACCGGAGCCGCTAGCAACGGCTGTCCCGTCGTGGGTCATATGAA
ATACCCCGTCGAGGGCGGCGGAAACCAGGACTGGTGGCCCAACCGGCTCAATCTGAAGGTACTGCACCAAAACCCGGCCG
TCGCTGACCCGATGGGTGCGGCGTTCGACTATGCCGCGGAGGTCGCGACCATCGACGTTGACGCCCTGACGCGGGACATC
GAGGAAGTGATGACCACCTCGCAGCCGTGGTGGCCCGCCGACTACGGCCACTACGGGCCGCTGTTTATCCGGATGGCGTG
GCACGCTGCCGGCACCTACCGCATCCACGACGGCCGCGGCGGCGCCGGGGGCGGCATGCAGCGGTTCGCGCCGCTTAACA
GCTGGCCCGACAACGCCAGCTTGGACAAGGCGCGCCGGCTGCTGTGGCCGGTCAAGAAGAAGTACGGCAAGAAGCTCTCA
TGGGCGGACCTGATTGTTTTCGCCGGCAACTGCGCGCTGGAATCGATGGGCTTCAAGACGTTCGGGTTCGGCTTCGGCCG
GGTCGACCAGTGGGAGCCCGATGAGGTCTATTGGGGCAAGGAAGCCACCTGGCTCGGCGATGAGCGTTACAGCGGTAAGC
GGGATCTGGAGAACCCGCTGGCCGCGGTGCAGATGGGGCTGATCTACGTGAACCCGGAGGGGCCGAACGGCAACCCGGAC
CCCATGGCCGCGGCGGTCGACATTCGCGAGACGTTTCGGCGCATGGCCATGAACGACGTCGAAACAGCGGCGCTGATCGT
CGGCGGTCACACTTTCGGTAAGACCCATGGCGCCGGCCCGGCCGATCTGGTCGGCCCCGAACCCGAGGCTGCTCCGCTGG
AGCAGATGGGCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATCACCAGCGGCATCGAGGTCGTA
TGGACGAACACCCCGACGAAATGGGACAACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCTGACGAAGAGCCC
TGCTGGCGCTTGGCAATACACCGCCAAGGACGGCGCCGGTGCCGGCACCATCCCGGACCCGTTCGGCGGGCCAGGGCGCT
CCCCGACGATGCTGGCCACTGACCTCTCGCTGCGGGTGGATCCGATCTATGAGCGGATCACGCGTCGCTGGCTGGAACAC
CCCGAGGAATTGGCCGACGAGTTCGCCAAGGCCTGGTACAAGCTGATCCACCGAGACATGGGTCCCGTTGCGAGATACCT
TGGGCCGCTGGTCCCCAAGCAGACCCTGCTGTGGCAGGATCCGGTCCCTGCGGTCAGCCACGACCTCGTCGGCGAAGCCG
AGATTGCCAGCCTTAAGAGCCAGATCCGGGCATCGGGATTGACTGTCTCACAGCTAGTTTCGACCGCATGGGCGGCGGCG
TCGTCGTTCCGTGGTAGCGACAAGCGCGGCGGCGCCAACGGTGGTCGCATCCGCCTGCAGCCACAAGTCGGGTGGGAGGT
CAACGACCCCGACGGGGATCTGCGCAAGGTCATTCGCACCCTGGAAGAGATCCAGGAGTCATTCAACTCCGCGGCGCCGG
GGAACATCAAAGTGTCCTTCGCCGACCTCGTCGTGCTCGGTGGCTGTGCCGCCATAGAGAAAGCAGCAAAGGCGGCTGGC
CACAACATCACGGTGCCCTTCACCCCGGGCCGCACGGATGCGTCGCAGGAACAAACCGACGTGGAATCCTTTGCCGTGCT
GGAGCCCAAGGCAGATGGCTTCCGAAACTACCTCGGAAAGGGCAACCCGTTGCCGGCCGAGTACATGCTGCTCGACAAGG
CGAACCTGCTTACGCTCAGTGCCCCTGAGATGACGGTGCTGGTAGGTGGCCTGCGCGTCCTCGGCGCAAACTACAAGCGC
TTACCGCTGGGCGTGTTCACCGAGGCCTCCGAGTCACTGACCAACGACTTCTTCGTGAACCTGCTCGACATGGGTATCAC
CTGGGAGCCCTCGCCAGCAGATGACGGGACCTACCAGGGCAAGGATGGCAGTGGCAAGGTGAAGTGGACCGGCAGCCGCG
TGGACCTGGTCTTCGGGTCCAACTCGGAGTTGCGGGCGCTTGTCGAGGTCTATGGCGCCGATGACGCGCAGCCGAAGTTC
GTGCAGGACTTCGTCGCTGCCTGGGACAAGGTGATGAACCTCGACAGGTTCGACGTGCGCTGA